Detailed information on ENST00000343087

lncRNA-RNA interactions

Number of interactions: 54

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000312828 ring finger protein 152 protein coding ENST00000343087 600 286 UTR3 Trans
ENST00000336505 suppressor of cancer cell invasion protein coding ENST00000343087 656 298 UTR3 Trans
ENST00000359543 epithelial membrane protein 2 protein coding ENST00000343087 660 302 UTR3 Trans
ENST00000375234 AhpC/TSA antioxidant enzyme domain containing 1 protein coding ENST00000343087 626 301 UTR3 Trans
ENST00000446045 AhpC/TSA antioxidant enzyme domain containing 1 protein coding ENST00000343087 626 301 UTR3 Trans
ENST00000494969 colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) protein coding ENST00000343087 616 302 CDS Trans
ENST00000548404 transcribed_unprocessed_pseudogene processed transcript ENST00000343087 538 276 noncoding Trans
ENST00000556539 signal transducer and activator of transcription 2, 113kDa processed transcript ENST00000343087 669 300 noncoding Trans
ENST00000572705 transient receptor potential cation channel, subfamily V, member 1 protein coding ENST00000343087 609 301 UTR3 Trans
ENST00000590442 zinc finger protein 532 retained intron ENST00000343087 633 298 noncoding Trans
ENST00000620788 pleckstrin homology-like domain, family B, member 1 retained intron ENST00000343087 603 306 noncoding Trans
TCONS_00013935 platelet-activating factor receptor novel protein coding ENST00000343087 628 297 UTR3 Trans
TCONS_00039782 GRAM domain containing 1B novel protein coding ENST00000343087 623 309 UTR5 Trans
TCONS_00059486 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000343087 669 300 UTR3 Trans
TCONS_00059487 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000343087 669 300 UTR3 Trans
TCONS_00059488 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000343087 669 300 UTR3 Trans
TCONS_00059489 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000343087 669 300 UTR3 Trans
TCONS_00059491 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000343087 669 300 UTR3 Trans
TCONS_00059493 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000343087 669 300 UTR3 Trans
TCONS_00059495 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000343087 669 300 UTR3 Trans
TCONS_00059497 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000343087 669 300 UTR3 Trans
TCONS_00061180 golgin A2 pseudogene 5 novel protein coding ENST00000343087 538 276 UTR5 Trans
TCONS_00065093 UBA domain containing 2 novel protein coding ENST00000343087 618 295 UTR5 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding ENST00000343087 618 295 UTR5 Trans
TCONS_00067572 DCN1, defective in cullin neddylation 1, domain containing 2 novel protein coding ENST00000343087 614 307 UTR3 Trans
TCONS_00080928 SH3-domain GRB2-like 3 novel protein coding ENST00000343087 606 298 UTR5 Trans
TCONS_00095049 epithelial membrane protein 2 novel protein coding ENST00000343087 660 302 UTR3 Trans
TCONS_00095050 epithelial membrane protein 2 novel protein coding ENST00000343087 660 302 UTR3 Trans
TCONS_00095052 epithelial membrane protein 2 novel protein coding ENST00000343087 660 302 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000343087 609 301 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000343087 605 267 UTR5 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000343087 692 294 UTR5 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000343087 605 267 UTR3 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000343087 692 294 UTR3 Trans
TCONS_00118919 potassium channel tetramerization domain containing 1 novel protein coding ENST00000343087 691 303 UTR3 Trans
TCONS_00118919 potassium channel tetramerization domain containing 1 novel protein coding ENST00000343087 617 307 UTR3 Trans
TCONS_00119961 ring finger protein 152 novel protein coding ENST00000343087 708 301 UTR5 Trans
TCONS_00119961 ring finger protein 152 novel protein coding ENST00000343087 600 286 UTR3 Trans
TCONS_00132247 zinc finger protein 43 novel noncoding ENST00000343087 622 297 noncoding Trans
TCONS_00140732 NCK adaptor protein 2 novel protein coding ENST00000343087 635 290 UTR5 Trans
TCONS_00143295 nucleoporin 35kDa novel protein coding ENST00000343087 634 305 UTR3 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding ENST00000343087 619 278 UTR3 Trans
TCONS_00148704 WD repeat containing planar cell polarity effector novel protein coding ENST00000343087 606 288 UTR3 Trans
TCONS_00148705 WD repeat containing planar cell polarity effector novel protein coding ENST00000343087 606 288 UTR3 Trans
TCONS_00171146 F-box and leucine-rich repeat protein 2 novel noncoding ENST00000343087 638 294 noncoding Trans
TCONS_00174508 calcium-sensing receptor novel protein coding ENST00000343087 609 298 UTR5 Trans
TCONS_00194682 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000343087 652 289 UTR3 Trans
TCONS_00216783 KH homology domain containing 1 novel noncoding ENST00000343087 623 277 noncoding Trans
TCONS_00233718 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2 novel protein coding ENST00000343087 626 279 UTR5 Trans
TCONS_00235205 epithelial splicing regulatory protein 1 novel protein coding ENST00000343087 616 306 UTR3 Trans
TCONS_00235219 epithelial splicing regulatory protein 1 novel protein coding ENST00000343087 616 306 UTR3 Trans
TCONS_00235231 epithelial splicing regulatory protein 1 novel protein coding ENST00000343087 616 306 UTR3 Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000343087 662 311 UTR3 Trans
TCONS_00249683 suppressor of cancer cell invasion novel protein coding ENST00000343087 656 298 UTR3 Trans

Sequence

>TCONS_00249683 (420 nt)
GGTTTTGTAACCAAAATTTAAAGTAAAGAAAACTGAAGTTTTGCTAGCAAACTCTTTAAAAATAATAAGAGACTGTTGGGCCGGGCACGGTGGCTCATGC
CTGTAATCCCAGCACTTTGGGAGGCTGAGTCGGGCGGATCGCCTGAGGTCGGGAGTTTGAGACCAACCTGACCAACATGGAGAAACCCCGTCTCTACTAA
AAATAAAAAATCAGCTGGACGTGGTGGCGCATGCCTGTAATTCCAGCTACTCAGGAGGCTGCGGCAGGAGAATCGCTTGAACCCAGGAGCAGGAGGTTGC
AGTGAGCCGAGATCACACCATTGCACTTCAGCCTGGGAAACAAGAGCAAAACTCCATCTCAAAAAAATAGAAAAAAAAAAGATACTGTTTTGAATTCAAA
ATAAATTATTATTCAAGAGAT

Expression



Full and truncated open reading frames discovered in TCONS_00249683

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.