Detailed information on ENST00000366109

lncRNA-RNA interactions

Number of interactions: 12

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000448612 WD repeat domain 27 protein coding ENST00000366109 506 280 CDS Trans
ENST00000511184 E74-like factor 2 (ets domain transcription factor) nonsense mediated decay ENST00000366109 531 270 CDS_UTR Trans
ENST00000568559 transmembrane protein 170A nonsense mediated decay ENST00000366109 592 274 UTR3 Trans
TCONS_00065093 UBA domain containing 2 novel protein coding ENST00000366109 615 274 UTR5 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding ENST00000366109 615 274 UTR5 Trans
TCONS_00065103 UBA domain containing 2 novel protein coding ENST00000366109 615 274 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000366109 554 273 UTR5 Trans
TCONS_00148698 WD repeat containing planar cell polarity effector novel noncoding ENST00000366109 604 271 noncoding Trans
TCONS_00148704 WD repeat containing planar cell polarity effector novel protein coding ENST00000366109 604 271 UTR3 Trans
TCONS_00148705 WD repeat containing planar cell polarity effector novel protein coding ENST00000366109 604 271 UTR3 Trans
TCONS_00185321 transferrin receptor novel protein coding ENST00000366109 603 275 UTR5 Trans
TCONS_00252827 discs, large homolog 3 (Drosophila) novel protein coding ENST00000366109 604 277 UTR5 Trans

Sequence

>TCONS_00252827 (577 nt)
GCATCTGAGAAGCTCTGGAAAAAACCTCTCAGGAAAACAACGACTTCAGCAGGACCCACTAGCCAAGGAAAGGGGATAAAATAAATAGCAAAGGGAAGGA
AAAACACGCACCTCTGGGATGCTGCAGGTCCTGTTGCAGCCGCCGCCATCCCTCGAAGCCACCGTTGCTTCTGCCAGAGCTGCTACTAGCGCGCTTATCA
GCTCCGCCACCGCCCAAGGGGGAAACTTCTGCAGAAACCCCAACCGAGCTTCCGTCTAACACAAGCTCCAGGCCGGGCGCCGTGGCTCACGCCTGTAATC
CCAGCACTTTGGGAGTCCGAGACGGGTGGATCACGAAGTCAGGAGTTCAAGACCAGCCTCGCCAAGATGCTGAAACCCCGTCTACGAAAAATACAAAAAT
TAGCCGGGCGTGATGGTGGGCGCCTGTAATCCCAGCTACTGGGGAGGCTGAGGCAGGAGAATCGCTTGAACCTGGGAGGCAGAGGTTGCAGTGAGCCGAG
ATCGCGCCACTGCACCACAGCCTGGGCGACAGAGCAAGACTCCTTAATAAATAAATAAATAAATAAAAAATAAATAAA

Expression



Full and truncated open reading frames discovered in TCONS_00252827

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.