Detailed information on ENST00000366206

lncRNA-RNA interactions

Number of interactions: 61

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000309060 zinc fingers and homeoboxes 3 protein coding ENST00000366206 661 298 UTR3 Trans
ENST00000409458 glycoprotein (transmembrane) nmb protein coding ENST00000366206 623 278 UTR3 Trans
ENST00000421422 zinc fingers and homeoboxes 3 protein coding ENST00000366206 661 298 UTR3 Trans
ENST00000439138 transmembrane protein 98 protein coding ENST00000366206 567 291 UTR5 Trans
ENST00000478730 ORAI calcium release-activated calcium modulator 2 protein coding ENST00000366206 613 296 UTR3 Trans
ENST00000498813 delta(4)-desaturase, sphingolipid 1 processed transcript ENST00000366206 608 301 noncoding Trans
ENST00000552918 spermatogenesis associated, serine-rich 2 protein coding ENST00000366206 618 282 UTR3 Trans
ENST00000553127 spermatogenesis associated, serine-rich 2 protein coding ENST00000366206 644 304 UTR3 Trans
ENST00000560870 sense_intronic sense intronic ENST00000366206 565 268 noncoding Trans
ENST00000591226 tropomyosin 4 retained intron ENST00000366206 619 300 noncoding Trans
ENST00000620139 melanoregulin protein coding ENST00000366206 629 301 UTR3 Trans
TCONS_00009834 SRY (sex determining region Y)-box 13 novel protein coding ENST00000366206 625 293 UTR3 Trans
TCONS_00010841 epoxide hydrolase 1, microsomal (xenobiotic) novel protein coding ENST00000366206 527 301 UTR3 Trans
TCONS_00028040 ankyrin repeat domain 16 novel protein coding ENST00000366206 636 288 UTR3 Trans
TCONS_00030588 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000366206 625 313 UTR3 Trans
TCONS_00030591 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000366206 563 295 UTR3 Trans
TCONS_00050741 spermatogenesis associated, serine-rich 2 novel protein coding ENST00000366206 644 304 UTR3 Trans
TCONS_00057601 transcribed_unprocessed_pseudogene novel protein coding ENST00000366206 634 293 UTR3 Trans
TCONS_00075827 forkhead box N3 novel protein coding ENST00000366206 604 301 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000366206 625 298 UTR5 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000366206 625 298 UTR3 Trans
TCONS_00116668 desmoglein 3 novel protein coding ENST00000366206 641 290 UTR3 Trans
TCONS_00119478 zinc finger and BTB domain containing 7C novel protein coding ENST00000366206 623 296 UTR5 Trans
TCONS_00124891 zinc finger protein 540 novel protein coding ENST00000366206 622 301 UTR5 Trans
TCONS_00140732 NCK adaptor protein 2 novel protein coding ENST00000366206 630 301 UTR3 Trans
TCONS_00141667 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000366206 610 290 UTR3 Trans
TCONS_00141679 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000366206 610 290 UTR3 Trans
TCONS_00142168 LY6/PLAUR domain containing 6B novel protein coding ENST00000366206 620 308 UTR5 Trans
TCONS_00147093 ATPase family, AAA domain containing 2B novel protein coding ENST00000366206 616 290 UTR3 Trans
TCONS_00147093 ATPase family, AAA domain containing 2B novel protein coding ENST00000366206 610 300 UTR3 Trans
TCONS_00147113 ATPase family, AAA domain containing 2B novel protein coding ENST00000366206 610 300 UTR5 Trans
TCONS_00150696 septin 10 novel protein coding ENST00000366206 612 291 UTR3 Trans
TCONS_00163095 T-cell lymphoma invasion and metastasis 1 novel protein coding ENST00000366206 559 300 UTR3 Trans
TCONS_00165715 LIM domain kinase 2 novel protein coding ENST00000366206 545 293 UTR3 Trans
TCONS_00165721 LIM domain kinase 2 novel protein coding ENST00000366206 545 293 UTR3 Trans
TCONS_00192331 tec protein tyrosine kinase novel protein coding ENST00000366206 515 289 UTR3 Trans
TCONS_00194652 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000366206 614 294 UTR5 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000366206 614 294 UTR5 Trans
TCONS_00195633 aspartylglucosaminidase novel protein coding ENST00000366206 533 273 UTR3 Trans
TCONS_00195828 LRP2 binding protein novel protein coding ENST00000366206 603 291 UTR5 Trans
TCONS_00200901 GM2 ganglioside activator novel protein coding ENST00000366206 622 286 UTR3 Trans
TCONS_00200902 GM2 ganglioside activator novel protein coding ENST00000366206 622 286 UTR3 Trans
TCONS_00203985 family with sequence similarity 169, member A novel protein coding ENST00000366206 636 300 UTR5 Trans
TCONS_00204911 erythrocyte membrane protein band 4.1 like 4A novel noncoding ENST00000366206 630 302 noncoding Trans
TCONS_00204916 erythrocyte membrane protein band 4.1 like 4A novel protein coding ENST00000366206 630 302 UTR3 Trans
TCONS_00211163 opioid growth factor receptor-like 1 novel protein coding ENST00000366206 607 312 UTR3 Trans
TCONS_00213191 tubby like protein 4 novel protein coding ENST00000366206 611 282 UTR5 Trans
TCONS_00213191 tubby like protein 4 novel protein coding ENST00000366206 618 302 UTR5 Trans
TCONS_00213738 enoyl-CoA delta isomerase 2 novel protein coding ENST00000366206 577 297 UTR3 Trans
TCONS_00213738 enoyl-CoA delta isomerase 2 novel protein coding ENST00000366206 606 303 UTR3 Trans
TCONS_00216910 high mobility group nucleosomal binding domain 3 novel noncoding ENST00000366206 646 305 noncoding Trans
TCONS_00226586 diacylglycerol kinase, beta 90kDa novel protein coding ENST00000366206 528 299 UTR3 Trans
TCONS_00226588 diacylglycerol kinase, beta 90kDa novel protein coding ENST00000366206 528 299 UTR3 Trans
TCONS_00232466 tumor suppressor candidate 3 novel protein coding ENST00000366206 518 282 UTR3 Trans
TCONS_00232467 tumor suppressor candidate 3 novel protein coding ENST00000366206 518 282 UTR3 Trans
TCONS_00240685 metastasis suppressor 1 novel protein coding ENST00000366206 515 233 UTR3 Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000366206 612 294 UTR3 Trans
TCONS_00243503 proprotein convertase subtilisin/kexin type 5 novel protein coding ENST00000366206 554 299 UTR3 Trans
TCONS_00243507 proprotein convertase subtilisin/kexin type 5 novel protein coding ENST00000366206 554 299 UTR3 Trans
TCONS_00251977 G protein-coupled receptor 82 novel protein coding ENST00000366206 577 302 UTR3 Trans
TCONS_00252827 discs, large homolog 3 (Drosophila) novel protein coding ENST00000366206 644 298 UTR5 Trans

Sequence

>TCONS_00252827 (574 nt)
AGTCATTTTTTCCAAAGCAAAGAGGATGAATATGCAAACACTCTTTATATTTATGGAATTCATTTGCCAGAAATTTGAATATATTTATAAATAGGAAAGT
GGTAGCTTTCAGATTTTTTTTTTCTTTTTTTTGAGACGGAGTCTCACTCTGTTACCCAGGCTGGAGTGCAATGGAACCATCTCAGCTCACTGCAACCTCC
ACCTCCCGGATTCAAGCGATTCTCCTGCCTCAGACTCCAGAGTAGCTGGGATTACAGGCGCATGCCACCACGCCCGGCCAGTTTTTGTATTTTTAATAGA
GACAGGTTTTCACCATGTTGGCCAGGCTGGTCTTGAACTGCTGACCTCAGGTGATCCACCCGCCACGGCCTCCCAAAGTGCTGGGATTACAGGTGTGAGC
CATGATGCCCAGCCCAGATTTAAATTATTGAGTAAAAGAGCACTGATTTTTTTAAAAATTGCCTGCTAATAAAGATGCCTTTCGAAAGACATGGAATCCC
AAGTATACACTACGTAGCCATTTTGATGGAGTACGGGCATTAGCTTTTCATCCTGTAGAACCTGTGCTGGTTACT

Expression



Full and truncated open reading frames discovered in TCONS_00252827

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.