Detailed information on ENST00000366253

lncRNA-RNA interactions

Number of interactions: 17

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000424496 sense_intronic sense intronic ENST00000366253 539 273 noncoding Trans
TCONS_00001821 low density lipoprotein receptor adaptor protein 1 novel protein coding ENST00000366253 636 278 UTR5 Trans
TCONS_00001823 low density lipoprotein receptor adaptor protein 1 novel protein coding ENST00000366253 636 278 UTR5 Trans
TCONS_00023682 pre-mRNA processing factor 18 novel protein coding ENST00000366253 608 281 UTR3 Trans
TCONS_00023685 pre-mRNA processing factor 18 novel protein coding ENST00000366253 608 281 UTR3 Trans
TCONS_00023687 pre-mRNA processing factor 18 novel protein coding ENST00000366253 608 281 UTR3 Trans
TCONS_00023689 pre-mRNA processing factor 18 novel protein coding ENST00000366253 608 281 UTR3 Trans
TCONS_00028040 ankyrin repeat domain 16 novel protein coding ENST00000366253 634 279 UTR3 Trans
TCONS_00030591 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000366253 602 274 UTR3 Trans
TCONS_00030592 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000366253 602 274 UTR3 Trans
TCONS_00039782 GRAM domain containing 1B novel protein coding ENST00000366253 600 279 UTR5 Trans
TCONS_00101169 myosin phosphatase Rho interacting protein novel protein coding ENST00000366253 519 267 UTR3 Trans
TCONS_00116668 desmoglein 3 novel protein coding ENST00000366253 606 280 UTR3 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000366253 620 265 UTR3 Trans
TCONS_00204911 erythrocyte membrane protein band 4.1 like 4A novel noncoding ENST00000366253 618 266 noncoding Trans
TCONS_00204916 erythrocyte membrane protein band 4.1 like 4A novel protein coding ENST00000366253 618 266 UTR3 Trans
TCONS_00247058 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 novel protein coding ENST00000366253 616 274 UTR3 Trans

Sequence

>TCONS_00247058 (574 nt)
GCATGACCTCTGCTAAAAAAAGTAGGATGAATCCTAAGGAAGTTAATAGCTGAAGGCTGCAGCTACTAGATTCCAGAGAGTGGCCTGGGGCACAAGATAC
TCAACCAGAGCAGACAGTGTCAGCCTCTGTCATGGAAAGCACAGAGCTTCCTATCCTACATGATTGTCTATTGTAATGCCAAATTACAAGCAATGGAGTC
TCACTGTGTTGCCCAGGCTGGAGTGCTGTGGCATGATCTCAGCTCACTGCCATCTCTGCCTCTTGAGTTCAAGCGATTCTCCTGCCTCAGCTTCCCAAGT
AGCTGGGATTACAGGCGCACGCCACCACGCCCCGCTAGTTTTTGTATTTTCAGTAGAGACGGGGTTTCACCATGTTGGCCAGACTGGTCTGTAACTCCAG
ACTTCAGGTGATCTGCCCACCTTGGCCTCCCAAAGTGCTGGGATTACAGGCCTGAGCCACCATGCCCAGCCAATTTCCATATATTTTTTATACTGGGATT
TCAGAGAGTAATTTCCTCTTCATGTGTAACCAGTTATGTGAATTAAAACAGATTCAGCCTTCTTTTACGGTTGTG

Expression



Full and truncated open reading frames discovered in TCONS_00247058

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.