Detailed information on ENST00000411553

lncRNA-RNA interactions

Number of interactions: 93

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000261839 myosin VC protein coding ENST00000411553 607 306 UTR3 Trans
ENST00000324537 SH3-domain GRB2-like 3 protein coding ENST00000411553 549 298 UTR5 Trans
ENST00000338758 parvin, beta protein coding ENST00000411553 648 292 UTR3 Trans
ENST00000338758 parvin, beta protein coding ENST00000411553 632 261 UTR3 Trans
ENST00000357491 zinc finger protein 43 protein coding ENST00000411553 609 280 UTR3 Trans
ENST00000357613 transmembrane protein 170A protein coding ENST00000411553 618 280 UTR3 Trans
ENST00000375120 OTU deubiquitinase 3 protein coding ENST00000411553 619 300 UTR3 Trans
ENST00000381431 sarcoglycan, beta (43kDa dystrophin-associated glycoprotein) protein coding ENST00000411553 605 294 UTR3 Trans
ENST00000399120 holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase) protein coding ENST00000411553 544 300 UTR5 Trans
ENST00000427746 holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase) protein coding ENST00000411553 544 300 UTR5 Trans
ENST00000448612 WD repeat domain 27 protein coding ENST00000411553 600 287 CDS Trans
ENST00000467462 inter-alpha-trypsin inhibitor heavy chain family, member 4 processed transcript ENST00000411553 528 299 noncoding Trans
ENST00000475187 THO complex 5 retained intron ENST00000411553 514 301 noncoding Trans
ENST00000475187 THO complex 5 retained intron ENST00000411553 551 282 noncoding Trans
ENST00000511184 E74-like factor 2 (ets domain transcription factor) nonsense mediated decay ENST00000411553 622 303 CDS_UTR Trans
ENST00000568559 transmembrane protein 170A nonsense mediated decay ENST00000411553 618 280 UTR3 Trans
ENST00000569540 transmembrane protein 170A protein coding ENST00000411553 618 280 UTR3 Trans
ENST00000588483 tropomyosin 4 protein coding ENST00000411553 588 295 UTR5 Trans
ENST00000588483 tropomyosin 4 protein coding ENST00000411553 590 279 UTR5 Trans
ENST00000593250 centrosomal protein 76kDa nonsense mediated decay ENST00000411553 508 296 UTR3 Trans
ENST00000594012 zinc finger protein 43 protein coding ENST00000411553 609 280 UTR3 Trans
ENST00000604000 Lix1 homolog (chicken) like protein coding ENST00000411553 563 295 UTR3 Trans
ENST00000607772 CNKSR family member 3 protein coding ENST00000411553 621 275 UTR3 Trans
ENST00000620139 melanoregulin protein coding ENST00000411553 609 279 UTR3 Trans
TCONS_00001594 lincRNA novel protein coding ENST00000411553 620 281 UTR5 Trans
TCONS_00030130 calcium/calmodulin-dependent protein kinase II gamma novel protein coding ENST00000411553 636 277 UTR3 Trans
TCONS_00050195 FYVE, RhoGEF and PH domain containing 4 novel protein coding ENST00000411553 644 300 UTR5 Trans
TCONS_00053851 transmembrane protein 263 novel protein coding ENST00000411553 616 285 UTR3 Trans
TCONS_00053851 transmembrane protein 263 novel protein coding ENST00000411553 634 257 UTR3 Trans
TCONS_00061878 transmembrane protein 116 novel protein coding ENST00000411553 645 294 UTR3 Trans
TCONS_00067572 DCN1, defective in cullin neddylation 1, domain containing 2 novel protein coding ENST00000411553 602 285 UTR3 Trans
TCONS_00075813 forkhead box N3 novel protein coding ENST00000411553 657 284 UTR5 Trans
TCONS_00075827 forkhead box N3 novel protein coding ENST00000411553 657 284 UTR3 Trans
TCONS_00083747 myosin VC novel protein coding ENST00000411553 607 306 UTR3 Trans
TCONS_00098745 transmembrane protein 170A novel protein coding ENST00000411553 618 280 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000411553 620 280 UTR5 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000411553 620 280 UTR3 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000411553 617 281 UTR3 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000411553 644 275 UTR3 Trans
TCONS_00107867 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000411553 617 281 UTR3 Trans
TCONS_00107867 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000411553 644 275 UTR3 Trans
TCONS_00108999 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000411553 617 280 UTR5 Trans
TCONS_00109000 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000411553 617 280 UTR5 Trans
TCONS_00109009 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000411553 617 280 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000411553 617 280 UTR5 Trans
TCONS_00109012 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000411553 617 280 UTR5 Trans
TCONS_00109013 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000411553 617 280 UTR5 Trans
TCONS_00109014 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000411553 617 280 UTR5 Trans
TCONS_00119512 zinc finger and BTB domain containing 7C novel protein coding ENST00000411553 579 302 UTR3 Trans
TCONS_00123889 ribosomal protein SA pseudogene 58 novel protein coding ENST00000411553 620 269 UTR5 Trans
TCONS_00123899 ribosomal protein SA pseudogene 58 novel protein coding ENST00000411553 620 269 UTR5 Trans
TCONS_00124891 zinc finger protein 540 novel protein coding ENST00000411553 664 291 UTR3 Trans
TCONS_00124891 zinc finger protein 540 novel protein coding ENST00000411553 665 284 UTR3 Trans
TCONS_00132233 zinc finger protein 43 novel protein coding ENST00000411553 609 280 UTR3 Trans
TCONS_00132247 zinc finger protein 43 novel noncoding ENST00000411553 608 259 noncoding Trans
TCONS_00132247 zinc finger protein 43 novel noncoding ENST00000411553 601 282 noncoding Trans
TCONS_00135884 zinc finger protein 347 novel protein coding ENST00000411553 550 264 UTR5 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding ENST00000411553 611 271 UTR3 Trans
TCONS_00147113 ATPase family, AAA domain containing 2B novel protein coding ENST00000411553 611 271 UTR3 Trans
TCONS_00147115 ATPase family, AAA domain containing 2B novel protein coding ENST00000411553 611 271 UTR3 Trans
TCONS_00148698 WD repeat containing planar cell polarity effector novel noncoding ENST00000411553 641 269 noncoding Trans
TCONS_00148704 WD repeat containing planar cell polarity effector novel protein coding ENST00000411553 641 269 UTR3 Trans
TCONS_00148705 WD repeat containing planar cell polarity effector novel protein coding ENST00000411553 641 269 UTR3 Trans
TCONS_00168418 dual specificity phosphatase 18 novel protein coding ENST00000411553 626 279 UTR5 Trans
TCONS_00173724 cms1 ribosomal small subunit homolog (yeast) novel protein coding ENST00000411553 605 276 UTR5 Trans
TCONS_00173729 cms1 ribosomal small subunit homolog (yeast) novel protein coding ENST00000411553 605 276 UTR5 Trans
TCONS_00184373 neutral cholesterol ester hydrolase 1 novel protein coding ENST00000411553 613 280 UTR3 Trans
TCONS_00185321 transferrin receptor novel protein coding ENST00000411553 620 280 UTR5 Trans
TCONS_00190276 transmembrane protein 144 novel protein coding ENST00000411553 627 281 UTR3 Trans
TCONS_00194682 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000411553 622 303 UTR3 Trans
TCONS_00194686 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000411553 622 303 UTR3 Trans
TCONS_00202828 myotubularin related protein 12 novel protein coding ENST00000411553 629 283 UTR3 Trans
TCONS_00213191 tubby like protein 4 novel protein coding ENST00000411553 655 284 UTR5 Trans
TCONS_00222403 protein tyrosine phosphatase, non-receptor type 12 novel protein coding ENST00000411553 604 295 UTR5 Trans
TCONS_00222403 protein tyrosine phosphatase, non-receptor type 12 novel protein coding ENST00000411553 602 252 UTR5 Trans
TCONS_00225244 family with sequence similarity 115, member C novel protein coding ENST00000411553 606 282 UTR3 Trans
TCONS_00225246 family with sequence similarity 115, member C novel protein coding ENST00000411553 606 282 UTR3 Trans
TCONS_00226448 collagen, type XXVIII, alpha 1 novel protein coding ENST00000411553 532 299 UTR5 Trans
TCONS_00226448 collagen, type XXVIII, alpha 1 novel protein coding ENST00000411553 532 258 UTR5 Trans
TCONS_00226450 collagen, type XXVIII, alpha 1 novel protein coding ENST00000411553 532 299 UTR5 Trans
TCONS_00226450 collagen, type XXVIII, alpha 1 novel protein coding ENST00000411553 532 258 UTR5 Trans
TCONS_00226462 lincRNA novel noncoding ENST00000411553 532 299 noncoding Trans
TCONS_00226462 lincRNA novel noncoding ENST00000411553 532 258 noncoding Trans
TCONS_00226463 lincRNA novel noncoding ENST00000411553 532 299 noncoding Trans
TCONS_00226463 lincRNA novel noncoding ENST00000411553 532 258 noncoding Trans
TCONS_00226468 lincRNA novel noncoding ENST00000411553 532 299 noncoding Trans
TCONS_00226468 lincRNA novel noncoding ENST00000411553 532 258 noncoding Trans
TCONS_00234854 zinc finger and BTB domain containing 10 novel protein coding ENST00000411553 631 277 UTR3 Trans
TCONS_00235281 NADH dehydrogenase (ubiquinone) complex I, assembly factor 6 novel protein coding ENST00000411553 613 259 UTR5 Trans
TCONS_00239255 tumor protein D52 novel protein coding ENST00000411553 607 294 UTR3 Trans
TCONS_00239255 tumor protein D52 novel protein coding ENST00000411553 647 284 UTR3 Trans
TCONS_00249092 transmembrane protein 245 novel protein coding ENST00000411553 615 282 UTR5 Trans
TCONS_00252827 discs, large homolog 3 (Drosophila) novel protein coding ENST00000411553 600 296 UTR5 Trans

Sequence

>TCONS_00252827 (3129 nt)
TTAACTCCTTACTTGAAACATTTAGACTATCTAGATGTTTAGAAGTGCCCGATGTATATTAAATGTAGAGGTAGTAAAATACCAATTTGTAAATATCTTT
TTGCTAAAATTCATAGGAAATACTTTTGGAAGTTGAATTGTGAAGCCACCTTTGTGAGCAGTATATTACTGTCTATACTTGCTCAATGGTTTAGAGGAGG
TGGGAGGGAAGAAATTGCAAAAGATAATATGCTAGTGTGTTCATACTTGGACATTTTCAGACACCATTTTTCTGTATGTTTTGTGCATTTTGTTTTGCTC
TGTATATAGTGTATATAATGGACAAATAGTCTTAATTTTTTAACATCTAGAGGTTGCCAGTGTATGACAAAGTAGTAAAATTAGCATATTTTGTATGCTT
TGTGTTGAAATTCATAGGAAAACTTGTCTTCTGTAATTGACTTTTGCATAGGAATTTGTTCAGCCATCTCTAAGCATTACACATGCGTGTACTTGTCCAC
TGAATTGAAGGCAGAGAAGGAAGAGAAGAGGGAATGATTCAAGGCCAAAATGGTCACATTTAGAAGATACCTTAGATGATAACCATTGTTATGTGTGTGC
AGTTTTATTTAACAGTGCCGTGTACATGGTGGACAGGCTATGAAATATCTAGTCTTTAGATATTTGGAAGTGCTTGATGTATTTTAAAGTAGTAGTAGTA
GAATAACACTTTTTGTAAATAGCTTTTAAAAACTGATGGGAAATGCTGTTTGGAAGTGGATTTGTTGAACCACCTGGGAGGTGGGAGGGAAAAAATTGCA
AAAGGTGTTTTGCCATTGTTTATTAGAAAATTTCAGCTTAATCCATTGCCTATATGTTACAAGCATTTCATTTAACTTTGCTATACTGTATATATTGTGT
ATATACTGGACAAATGAGTCCTGATTTTATAATATCTAGTCTGTAGCTATTAAAGAGGTTGCCAGTGTATGACAAAAGTAGTTAGTAAACTAACGCATTT
TGTACACTTTGTTAAAATTCATAGAGAGGCTGTCTTCTGAAAAGGACTTTTTGGAAGTGAAATGATAACATCAGCTCGAAGTGACACATGTGCTTATATC
CACCAGGTTGGTGGTGGAGAGGAGTTGGAAGGAATGAAGGGTTCTAGACCAGAATGTTCCTATTTAGAAGACACTTTCAGATATAACCATTGTTACATGT
GTGTAGTTTATTCAACAGTGCTATGTATATAGTGGACACACTTAAGTCCTTATTTGAAATATCTAGTCTTTCTAGATGTTTAGAAGTGCACAAAGCATGT
TAAAAGTAGAGGTAGTAAGTAACACATTTTGTAGTTATTTTGATATGAAATATTGTCTTGGAAATTGATCAATTCTCTGAGAAGTACACGTTATGATATT
TGTGCTGGTTCAGGGGGAAGAAGGAGCACAAAGTTCAAAGGGCTTTCTACCAGTGTCCAGTGTGTTTATGATGAGGCACATTGACCATTGTCCCTTATGT
CTGCATTTTCGTTTACTGTGCTGTGTATATAAGCAGACATAGGAGTCCTAATTTATATCTAGTCGATGTTAAAGAGGTTGCCAGTGTATGGCAAAAGTAG
AGTTAGTAAACTAATACATTGAGTACACTTTGTGTTAAAATTCATAAGGAACACTTCTTAAAAACAGAAGTAAAATTGTTAAACGCCCCCCGCCCCCAAG
CATTACAGATGGCTTATAGCTGTCAACGGGGTTGGTAGAGGTCAGAAAGGGAAGTGTTCTAGGCCAGAATGTTCCTATTTAGAAGACACTCAAATTATAG
TCTATGTTATGTATATATGCCATTTATTCAATACTACTGTGTATATAATGGAAAACTTAAGTGCAGTTTGAAACATCTAGTCTTTCTAGGTGTTTAAAAG
TGCACAATGGTCAGGTGCGGTGGCTCACTCCTGTAATCCTGGCACTTTGGGAGGCTGAGGTGGGCAGATCACGAAGTCAAGGGATCGAGACTATCTTGGC
CAACATGGTGAAACCCCATCTCTACAAAAAATACAAAAATTAGCTGGTCGTGGTGGCACATGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGA
ATCGCTTGAGCCCGGGAGACAGAGGTTGCAGTAAGCCGAGACCACACCACTGCACTCCAGCATGGCGACAGAGCAAGACTCCATCTCAAAAAAAAAAAAA
AAAAAAAATTCCACAACATAGGTTAAAAGTAGAGGGCTAAAGTAACACCCCTCTAAGCATTTGTTTTCAGTACTTCCTAGGAGTGGTTGCATTTGGGAAT
GGAATTGTTAAAACTTGATGCTTAGGAGCGTATGCTGACTATTCACTGCGTGGTGGGGTGGGGAGGAGGAGGAGGTATGCAGGGAGAAGGGTTCTGTGCC
CCTGAGTTAGATTAGTTCAGATGGTCTAACCATTGTTCTATGTATGCATTTTATTGTGTTAATATTGTGTATTAAAGGATAAACAAGTCTTAATGCTCAA
AGTATGTTAAAAATAGATGTAGTGAATCAGTCCCTTTGTGAATGTCCTATTGTTAGTTTTTAGGAAGGCCTGTCTTCTGGGAGTGACCTTTATTAGTCCA
CTTCTTGGAGCTAGACGTCCTATACTTAGTCACTGGGGATGGTGAAAGAGGGAGAAGAGGAAGGGCGAAGGGAAGGGCTCTTTGCTAGTATCTCCATTTC
TAGAAGATGGTTTTAGATGATAACCACAGGTCTATATGAGCATTTTTAGTAAAGTGCCTGTGTTTATTGTGGACAGAGTTTATTATTTTGCAACATCTAA
CCTTTATGAATATCTGAGGTGACAATGTGTGATAAAAACTAGAGCTAGTGGGCCAGGCGCGGTGGCTCATGCCTGTAATCCCAACATTTTGGGAGGCTGA
GGCAGGCAGATCACAAGGTCAAGAGATCGAGACCATCCTGGTCAACATGGTGAAACCCCATCTCTACTAAAAATACAAAAATTAGCTGGGCGTGGTGGCG
CGTGCCTGTAGTCCCAGCTTCTCAGGAGGCTGAGGCAGGAGAATCACTTGAACCTGGGAGGCGGAGGTTGCAGTGAGCCAATATTGCGCCACTGCACTCC
AGCCTGGGCAACACAGCAAGACTCCATCTC

Expression



Full and truncated open reading frames discovered in TCONS_00252827

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.