Detailed information on ENST00000421004

lncRNA-RNA interactions

Number of interactions: 41

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000361228 Ras association (RalGDS/AF-6) domain family (N-terminal) member 9 protein coding ENST00000421004 574 299 UTR3 Trans
ENST00000397755 zinc finger family member 788 processed transcript ENST00000421004 507 293 noncoding Trans
ENST00000399120 holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase) protein coding ENST00000421004 639 278 UTR5 Trans
ENST00000427746 holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase) protein coding ENST00000421004 660 296 UTR5 Trans
ENST00000432564 hydroxycarboxylic acid receptor 1 protein coding ENST00000421004 619 293 UTR3 Trans
ENST00000467462 inter-alpha-trypsin inhibitor heavy chain family, member 4 processed transcript ENST00000421004 552 297 noncoding Trans
ENST00000517408 antisense antisense ENST00000421004 578 296 noncoding Trans
ENST00000524264 SAP30L antisense RNA 1 (head to head) antisense ENST00000421004 535 295 noncoding Trans
ENST00000604000 Lix1 homolog (chicken) like protein coding ENST00000421004 616 296 UTR3 Trans
TCONS_00070307 pecanex homolog (Drosophila) novel protein coding ENST00000421004 658 291 UTR5 Trans
TCONS_00075813 forkhead box N3 novel protein coding ENST00000421004 673 296 UTR5 Trans
TCONS_00075827 forkhead box N3 novel protein coding ENST00000421004 673 296 UTR3 Trans
TCONS_00082423 transcribed_processed_pseudogene novel protein coding ENST00000421004 604 295 UTR3 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000421004 633 299 UTR3 Trans
TCONS_00107867 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000421004 633 299 UTR3 Trans
TCONS_00108999 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000421004 602 297 UTR5 Trans
TCONS_00109000 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000421004 602 297 UTR5 Trans
TCONS_00109009 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000421004 602 297 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000421004 584 300 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000421004 602 297 UTR5 Trans
TCONS_00109012 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000421004 602 297 UTR5 Trans
TCONS_00109013 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000421004 602 297 UTR5 Trans
TCONS_00109014 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000421004 602 297 UTR5 Trans
TCONS_00109427 serine hydroxymethyltransferase 1 (soluble) novel protein coding ENST00000421004 633 294 UTR3 Trans
TCONS_00123889 ribosomal protein SA pseudogene 58 novel protein coding ENST00000421004 613 286 UTR5 Trans
TCONS_00123899 ribosomal protein SA pseudogene 58 novel protein coding ENST00000421004 613 286 UTR5 Trans
TCONS_00124891 zinc finger protein 540 novel protein coding ENST00000421004 626 297 UTR5 Trans
TCONS_00148698 WD repeat containing planar cell polarity effector novel noncoding ENST00000421004 616 279 noncoding Trans
TCONS_00148704 WD repeat containing planar cell polarity effector novel protein coding ENST00000421004 616 279 UTR3 Trans
TCONS_00148705 WD repeat containing planar cell polarity effector novel protein coding ENST00000421004 616 279 UTR3 Trans
TCONS_00161482 BTB and CNC homology 1, basic leucine zipper transcription factor 1 novel protein coding ENST00000421004 600 296 UTR3 Trans
TCONS_00161618 interferon gamma receptor 2 (interferon gamma transducer 1) novel protein coding ENST00000421004 626 295 UTR3 Trans
TCONS_00185321 transferrin receptor novel protein coding ENST00000421004 618 288 UTR5 Trans
TCONS_00203663 ribosomal protein L3 pseudogene 6 novel protein coding ENST00000421004 594 294 UTR3 Trans
TCONS_00212185 TEC novel protein coding ENST00000421004 513 296 UTR3 Trans
TCONS_00229218 leucine-rich repeats and death domain containing 1 novel protein coding ENST00000421004 617 297 UTR3 Trans
TCONS_00229219 leucine-rich repeats and death domain containing 1 novel protein coding ENST00000421004 617 297 UTR3 Trans
TCONS_00233179 BCL2/adenovirus E1B 19kDa interacting protein 3-like novel protein coding ENST00000421004 619 298 UTR3 Trans
TCONS_00235393 processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae) novel protein coding ENST00000421004 640 298 UTR5 Trans
TCONS_00242866 glyoxylate reductase/hydroxypyruvate reductase novel protein coding ENST00000421004 600 299 UTR3 Trans
TCONS_00249092 transmembrane protein 245 novel protein coding ENST00000421004 639 283 UTR5 Trans

Sequence

>TCONS_00249092 (1478 nt)
TCCTGGCCGCGGCGCAGCTCGCGTTCGCCATCCCGTTCCTCCGGGCCCGGATCCCACGCTCCGGGCTTTAGCTGCGACCGAGTAGGCAGTCGGGGCGAAG
GAAACGGGAACTGAAAGCGATGAAAAGCGTTCCACACGCCACGAGCCCGCGGGATCCTCGGAGAGTATGGAACCCTTCCCCTCCGCTCTCAGCCGGAGGC
CAGCTGCGTCCAGCCGGGCTCGGTCTTCTGAACACCGATTTCAAATCAGGTCCTCGGGGCCCAGCGTCACTTAGGGAAGTGGTGGCATTTTGTGGTTGCT
GCTAAATCACGGAGAGCAGCCTTGGCGCTGCCGGTCCCAACTTGATCCAAGGAGCCTTGAGAAGGAGATGAGATTCAGTACCAGGGGCCGGCCGTGGCTC
CCATCCTCCGGAATCTGCAAAATGGCTACTTCTTCAGAAATAATGGGGAGAGGGATGGCAAGAGGCCAGAGATCAAGGCCCTCGAGTATTAACTTGAGCA
TTTGGGCACAAAATAGACACTTTTGGATTTTCCCGTCTTTTCCAACACCAAGGATGAGATTATCAAAAGATGTGTTAAATTAATTTGTACCGGCCGGGCG
CGGTGGCTTACGCCTGTAATCCCAACACTTTGGGAGGCCGAGGCGGGCGAATCACAAGGTCATGAGTTCGAAACCAGCCTGGCCAATATGGTGAAACCCC
CGTCTCTACTAAAAATACAGAAATTAGCCGGGAGTGGTGGCGTACGCCTGTAGTCCCAGCTACTCTGGAGGCTAAGGCAGGAGAATCGCTTGAATCCGGG
AGGTGGAGGTCGCAGTGAGCCGAGACCGGGCCACTGCACTCCAGCCTGGGAGACAGAGCGAGACTCTGTCTCAAGAAAAAAAAAAAATCAATTTGTACCA
TTCCTTGCCCCACCCTGCCGAACTTATTGAAAGAGCATCGCTTTCCTCACTTTTCTCCTCTAACAGAAAAGCACTTAGATGAAGCTACAGGGAGCCAGAA
TTCTTTTGACTTGGTGGGTACCGGAGGATTGGAAGAATCTAGATTGAGTATTCCTTGGCCTTTGGGGAGCTTGCTCTATGCAAAGTCACCCAGGAAATGA
TACTCCCCCCACTGTGAAACACTAGCTAGAGATGATAGACAAAAAGCACATTTGTTGTAATCTCCCTTTGACGGGATTCAGGTTGGGATAGATGTCGAAG
CAGCTGCTTCTAGGTAGTCAACGAAGATGTCAACTAGTAAATGACAACAGACAAGGATGAGCACAGCAGAGCTGTACGATTCTAGATATCAAAAAGAGCA
AGCAGTCTGTTGTACTCACCATCGCATCCTCAGCAGCTGCCCAGTGCCCGGTTTTAACTTAGTGCTCAGTGTATGTGTCAGGTTTGAATCCCAATTCTGA
TACTACCTGTGCTACTCTCTTCACCTCTCTGAGTCTGTAAAGGATTATTTAAGAATTAAATGAAACAACATACAGAAAA

Expression



Full and truncated open reading frames discovered in TCONS_00249092

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.