| Potential function | Interacting transcript | Gene description | Transcript biotype | lncRNA id | Alignment score (LAST) | Alignment length | Transcript region involved in interaction | Genomic orientation of interacting RNAs |
|---|---|---|---|---|---|---|---|---|
| ENST00000339732 | polypeptide N-acetylgalactosaminyltransferase 15 | protein coding | ENST00000434211 | 606 | 303 | UTR3 | Trans | |
| ENST00000439138 | transmembrane protein 98 | protein coding | ENST00000434211 | 620 | 312 | UTR5 | Trans | |
| ENST00000478730 | ORAI calcium release-activated calcium modulator 2 | protein coding | ENST00000434211 | 602 | 287 | UTR3 | Trans | |
| ENST00000513143 | podoplanin | protein coding | ENST00000434211 | 536 | 302 | UTR5 | Trans | |
| ENST00000569832 | SSTR5 antisense RNA 1 | lincRNA | ENST00000434211 | 526 | 289 | noncoding | Trans | |
| ENST00000591226 | tropomyosin 4 | retained intron | ENST00000434211 | 608 | 293 | noncoding | Trans | |
| TCONS_00030588 | cytoplasmic polyadenylation element binding protein 3 | novel protein coding | ENST00000434211 | 610 | 288 | UTR3 | Trans | |
| TCONS_00030591 | cytoplasmic polyadenylation element binding protein 3 | novel protein coding | ENST00000434211 | 606 | 288 | UTR3 | Trans | |
| TCONS_00030591 | cytoplasmic polyadenylation element binding protein 3 | novel protein coding | ENST00000434211 | 618 | 302 | UTR3 | Trans | |
| TCONS_00030591 | cytoplasmic polyadenylation element binding protein 3 | novel protein coding | ENST00000434211 | 610 | 288 | UTR3 | Trans | |
| TCONS_00030591 | cytoplasmic polyadenylation element binding protein 3 | novel protein coding | ENST00000434211 | 619 | 288 | UTR3 | Trans | |
| TCONS_00030592 | cytoplasmic polyadenylation element binding protein 3 | novel protein coding | ENST00000434211 | 618 | 302 | UTR3 | Trans | |
| TCONS_00030592 | cytoplasmic polyadenylation element binding protein 3 | novel protein coding | ENST00000434211 | 606 | 288 | UTR3 | Trans | |
| TCONS_00144404 | miRNA | novel protein coding | ENST00000434211 | 519 | 303 | UTR3 | Trans | |
| TCONS_00191796 | G protein-coupled receptor 125 | novel protein coding | ENST00000434211 | 609 | 307 | UTR5 | Trans | |
| TCONS_00191797 | G protein-coupled receptor 125 | novel protein coding | ENST00000434211 | 609 | 307 | UTR3 | Trans | |
| TCONS_00202516 | family with sequence similarity 173, member B | novel protein coding | ENST00000434211 | 653 | 313 | UTR3 | Trans | |
| TCONS_00203985 | family with sequence similarity 169, member A | novel protein coding | ENST00000434211 | 601 | 302 | UTR5 | Trans | |
| TCONS_00216910 | high mobility group nucleosomal binding domain 3 | novel noncoding | ENST00000434211 | 623 | 289 | noncoding | Trans | |
| TCONS_00232466 | tumor suppressor candidate 3 | novel protein coding | ENST00000434211 | 518 | 284 | UTR3 | Trans | |
| TCONS_00232467 | tumor suppressor candidate 3 | novel protein coding | ENST00000434211 | 518 | 284 | UTR3 | Trans | |
| TCONS_00235292 | NADH dehydrogenase (ubiquinone) complex I, assembly factor 6 | novel protein coding | ENST00000434211 | 599 | 328 | UTR3 | Trans | |
| TCONS_00247058 | UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 | novel protein coding | ENST00000434211 | 645 | 288 | UTR3 | Trans |
>TCONS_00247058 (556 nt)
CTTCCCCACCAACATCCCAGGGCCCGATTTTTATGGTAATTATGTCCTGCTTGTCTCTATTATTTTGTCAGCTAAGTATCCCTAAACAATATGGTCTGGT
TTTTTGTTTGTTTTTGTTTGTTTGTTTTTTTCAGACGGAGTTTCACTCTGTCACCCAGGCTGGAGTGCAGTGGCATGATCTCGGCTCACTGCCACCTTGG
CCTCCTGGGTTCAAGGAATTCTCAGGCCTCAGCCTCATGAGTAGCTGAGATTACAGGCGCTGTCCACTGCACCTGGCTAATTTTTGTATTTTTAGTAGAG
ACGGGGTTTTGCCATGTTGACCAGGCTGGTCTTGAACTCCTGACCTCAGGCGATCCGCCCGCCTTGAACTCCCAAAGTGCTGGGATTACAGGTGTGAGCC
ACCGTGCCCGGCACCTAAACAACATAGTTTTGATATAGACAAGAAGACAAGAAAATGATTTGAGGACAGCTTCAATCGCGGTGTGAAGAAGAAAGCAACA
AAACGACCACTGAAAACAATGCCGGTGGCAAAACATCCAAAGAAAGGGTCCCAAGTG
In silico ORF/peptide predictions
Nothing found.
RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.