| Potential function | Interacting transcript | Gene description | Transcript biotype | lncRNA id | Alignment score (LAST) | Alignment length | Transcript region involved in interaction | Genomic orientation of interacting RNAs |
|---|---|---|---|---|---|---|---|---|
| ENST00000276431 | tumor necrosis factor receptor superfamily, member 10b | protein coding | ENST00000445785 | 552 | 286 | UTR3 | Trans | |
| ENST00000450928 | antisense | antisense | ENST00000445785 | 557 | 298 | noncoding | Trans | |
| ENST00000494969 | colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) | protein coding | ENST00000445785 | 569 | 301 | CDS | Trans | |
| ENST00000521027 | pleckstrin and Sec7 domain containing 3 | protein coding | ENST00000445785 | 539 | 297 | CDS_UTR | Trans | |
| TCONS_00027001 | programmed cell death 4 (neoplastic transformation inhibitor) | novel protein coding | ENST00000445785 | 511 | 288 | UTR3 | Trans | |
| TCONS_00027009 | programmed cell death 4 (neoplastic transformation inhibitor) | novel protein coding | ENST00000445785 | 511 | 288 | UTR3 | Trans | |
| TCONS_00065093 | UBA domain containing 2 | novel protein coding | ENST00000445785 | 615 | 309 | UTR5 | Trans | |
| TCONS_00065094 | UBA domain containing 2 | novel protein coding | ENST00000445785 | 615 | 309 | UTR5 | Trans | |
| TCONS_00065103 | UBA domain containing 2 | novel protein coding | ENST00000445785 | 615 | 309 | UTR5 | Trans | |
| TCONS_00067572 | DCN1, defective in cullin neddylation 1, domain containing 2 | novel protein coding | ENST00000445785 | 634 | 299 | UTR3 | Trans | |
| TCONS_00119512 | zinc finger and BTB domain containing 7C | novel protein coding | ENST00000445785 | 602 | 277 | UTR3 | Trans | |
| TCONS_00147093 | ATPase family, AAA domain containing 2B | novel protein coding | ENST00000445785 | 620 | 293 | UTR3 | Trans | |
| TCONS_00147093 | ATPase family, AAA domain containing 2B | novel protein coding | ENST00000445785 | 622 | 291 | UTR3 | Trans | |
| TCONS_00147100 | ATPase family, AAA domain containing 2B | novel protein coding | ENST00000445785 | 622 | 291 | UTR3 | Trans | |
| TCONS_00147106 | ATPase family, AAA domain containing 2B | novel protein coding | ENST00000445785 | 622 | 291 | UTR3 | Trans | |
| TCONS_00235685 | oxidation resistance 1 | novel protein coding | ENST00000445785 | 615 | 285 | UTR3 | Trans | |
| TCONS_00235708 | oxidation resistance 1 | novel protein coding | ENST00000445785 | 615 | 285 | UTR3 | Trans |
>TCONS_00235708 (1339 nt)
GTCTGTAACAATTTTAAAATAAAAGCCAGCATATTGGTGGGAAAAAAAACAAAAATCCAACAACAACAAAAATAAAACACAACAAGGCATATACTTCCAA
TATTTCCACTGTATAAACCCAATCCATGGATTATGCAAAAGAGATAAGTCTCTTGGAAATGACAGTCATTTGGTGACAATAACAAATCAGCAACAGAGGA
GACTTTAACGAGTTACTCACTGTTTCCTCCCTCACCAAAGGCATCTGCTAAGTCAAAGTCTGCCCCTAAAGGAAGGAATCGGTCTGTTCATAGTAAAGCT
CTGAGAAATGAGGAAGGAATGACCTCGGAAACAGATGGAGAAATCACCAGAGACCCACATGACTAAAGACTTTTCTGAATATCACACTGACTAGGATCTC
ATTTGAAAAAGTAAATTCCTGATCATTTTCACATCATTCTTCCCCCAGATGAAAAGAGTAAGAGATGACAGCAAGAGAAAGAGGGAGAGAGAAAGAATGT
CATTTGTAAATCAACTGTGCTGCCTGGACCCAGTTGGGACTCTGAATCTGCCTGCACACAACTCTGTCCCGTTGATTCCCCATTATCTCCTCCCAGGTCC
CCAACACCTTCAGCAAGGCAGACCGTAAGAGAAATAAACAGAAAAATAGTGGACATGAAAATGGATTCAGAGTAACAAAAACAAGGAAAAAACACTTTAG
AAACCCATTGACAGAATCAACAAGAGGAAGAGACAAATCGAATCTCAAAGAAAAAGCTCAGGCCGGCATGGTGGCTCACACCTGTAATCCCAGCACTTTG
AGAGGCTGAGATGGGCGGATCACCTGAGGTCAGGGGTTCAAGATCAGCCTGGCTAACATGGCAAAACCCCGTCTCTACTGAAAATACAAGAATTTGCCGG
GCATGGTGGTGCATGTTTGTAATCCTAGCTAATTGGGAGGCTGAGGCACGAGAATTGCTTGAACCCAGGAAGTGGAGGTTGCACTGAGCCAAGATCACGC
CACTGCACTCCAGCCCGGGCGACAGAGAGAGACTCTGTCTCCAAAATAAAAAAAGGAAAGAAAATAAAAGAAAAAACTCAACATTGAAAACGTGTTACCA
TTCCTTCAATCAACCTATGGTGATAAACAATTCAAATGAAATTAAAAAGAAGGTTTTACTTCTCTGAAGAGAAGGGACAATAGCAAAATGATTCTCAATT
TAAAAGGAAAAAAAGTTACAAAAAGCAGGATATCCACACAAACATAAGACACCATAAAAAAATAAACATACCACTTGTAAAACATTCCTGTTAAAAATAT
TCAAAGGCAAAAATAAAGTGCAAAACCATTTTCATAATAA
In silico ORF/peptide predictions
Nothing found.
RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.