| Potential function | Interacting transcript | Gene description | Transcript biotype | lncRNA id | Alignment score (LAST) | Alignment length | Transcript region involved in interaction | Genomic orientation of interacting RNAs |
|---|---|---|---|---|---|---|---|---|
| ENST00000338977 | zinc finger protein 721 | protein coding | ENST00000457283 | 608 | 294 | UTR3 | Trans | |
| ENST00000345714 | serum/glucocorticoid regulated kinase family, member 3 | protein coding | ENST00000457283 | 635 | 298 | UTR3 | Trans | |
| ENST00000367590 | xenotropic and polytropic retrovirus receptor 1 | protein coding | ENST00000457283 | 501 | 252 | UTR3 | Trans | |
| ENST00000592474 | phosphoribosyl pyrophosphate synthetase-associated protein 1 | retained intron | ENST00000457283 | 621 | 288 | noncoding | Trans | |
| ENST00000620139 | melanoregulin | protein coding | ENST00000457283 | 554 | 298 | UTR3 | Trans | |
| ENST00000621141 | G protein-coupled receptor 1 | protein coding | ENST00000457283 | 547 | 283 | UTR3 | Trans | |
| TCONS_00009095 | xenotropic and polytropic retrovirus receptor 1 | novel protein coding | ENST00000457283 | 501 | 252 | UTR3 | Trans | |
| TCONS_00021902 | protein tyrosine phosphatase, non-receptor type 14 | novel protein coding | ENST00000457283 | 618 | 298 | UTR3 | Trans | |
| TCONS_00021903 | protein tyrosine phosphatase, non-receptor type 14 | novel protein coding | ENST00000457283 | 618 | 298 | UTR3 | Trans | |
| TCONS_00030588 | cytoplasmic polyadenylation element binding protein 3 | novel protein coding | ENST00000457283 | 622 | 290 | UTR3 | Trans | |
| TCONS_00043422 | vacuolar protein sorting 37 homolog C (S. cerevisiae) | novel protein coding | ENST00000457283 | 636 | 297 | UTR5 | Trans | |
| TCONS_00065859 | ubiquitin specific peptidase 12 | novel protein coding | ENST00000457283 | 668 | 294 | UTR3 | Trans | |
| TCONS_00133831 | carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) | novel protein coding | ENST00000457283 | 611 | 296 | UTR3 | Trans | |
| TCONS_00147093 | ATPase family, AAA domain containing 2B | novel protein coding | ENST00000457283 | 609 | 296 | UTR3 | Trans | |
| TCONS_00148450 | coiled-coil domain containing 88A | novel protein coding | ENST00000457283 | 637 | 301 | UTR3 | Trans | |
| TCONS_00189321 | transcribed_unprocessed_pseudogene | novel protein coding | ENST00000457283 | 612 | 302 | UTR5 | Trans | |
| TCONS_00189329 | transcribed_unprocessed_pseudogene | novel protein coding | ENST00000457283 | 612 | 302 | UTR5 | Trans | |
| TCONS_00189333 | transcribed_unprocessed_pseudogene | novel protein coding | ENST00000457283 | 612 | 302 | UTR5 | Trans | |
| TCONS_00189336 | transcribed_unprocessed_pseudogene | novel protein coding | ENST00000457283 | 612 | 302 | UTR5 | Trans | |
| TCONS_00189341 | transcribed_unprocessed_pseudogene | novel protein coding | ENST00000457283 | 612 | 302 | UTR5 | Trans | |
| TCONS_00190999 | zinc finger protein 721 | novel protein coding | ENST00000457283 | 608 | 294 | UTR3 | Trans | |
| TCONS_00194652 | E74-like factor 2 (ets domain transcription factor) | novel protein coding | ENST00000457283 | 608 | 294 | UTR5 | Trans | |
| TCONS_00194655 | E74-like factor 2 (ets domain transcription factor) | novel protein coding | ENST00000457283 | 608 | 294 | UTR5 | Trans | |
| TCONS_00194655 | E74-like factor 2 (ets domain transcription factor) | novel protein coding | ENST00000457283 | 617 | 303 | UTR3 | Trans | |
| TCONS_00194686 | E74-like factor 2 (ets domain transcription factor) | novel protein coding | ENST00000457283 | 679 | 298 | UTR3 | Trans | |
| TCONS_00199319 | sorting nexin 24 | novel noncoding | ENST00000457283 | 606 | 290 | noncoding | Trans | |
| TCONS_00204911 | erythrocyte membrane protein band 4.1 like 4A | novel noncoding | ENST00000457283 | 619 | 298 | noncoding | Trans | |
| TCONS_00204916 | erythrocyte membrane protein band 4.1 like 4A | novel protein coding | ENST00000457283 | 619 | 298 | UTR3 | Trans | |
| TCONS_00240832 | ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 | novel protein coding | ENST00000457283 | 607 | 285 | UTR3 | Trans | |
| TCONS_00243477 | osteoclast stimulating factor 1 | novel protein coding | ENST00000457283 | 615 | 298 | UTR5 | Trans | |
| TCONS_00243482 | osteoclast stimulating factor 1 | novel protein coding | ENST00000457283 | 615 | 298 | UTR5 | Trans | |
| TCONS_00252827 | discs, large homolog 3 (Drosophila) | novel protein coding | ENST00000457283 | 628 | 295 | UTR5 | Trans |
>TCONS_00252827 (1444 nt)
AGGAGGGACGTCAGTAGAGCCCCCGAAGGCCCACTAGAGGGGATGGAAACTAAGGGCCGATGGCTGCGAGTCCATGGTCAGAACTGGACGATGTCTTCAA
ATAAAACGGCGGCAGCGCGACCTCTCGACCTTTGCCCCTGCGCAATTGTACCCACGACGACGCCCCCCTCCCCGCGCCCCCGCTCCAGGCCCAGTTCTCT
CCTTGCCCTAATCCAAAATGGCCGTTGCGGCTACAGGCGCCGGCCTTGAAAACCAGCCGCGCATGCTCCGGCCCCGCCAGGTGAGGCGGCGCAGCTCAGA
GCTTCCGCCCGGGTTTGCGGGAACAAAGCAGCGCCCTGCGGAAGGCAGCCCTCGTGAACTCAGAAGTTAGTTTTCGTCTCTGGACCTTTTTATAATCGGA
CTTCAGCCCATCACTGTCTCGTTTTGTCCTCAGAAACGGCGACAGCAGCCTCTTCCCAATGTTGAGAGCAAAAAGTGTGAACCCAGAAATTCCGAGACAG
ATCTCAATTACTTGCCAAGGTTGAGGACGCGCGCGTGACAGCCTCAGGAAGTCCTCACGACATGTGCCCAAGGTGGTCTGGGCATAGCTTAGTTTTATAC
ATTTTATGGAGACATGAGACATCAATAAATGTATGTAAGAAGTACATTGGTTCTGTTTGGAAAGGCGGGGCAACTTGAAGCAAAGGCAGGAAGACGTGAA
GCAGGAAGGGGGCTTCCAAGAAACAGAAGAGACAAGTGAACATTTATTTTTATGTCTTTCTTCCTATGTGTATTTCAAGTCTTTTTCAAAACAAGGCCCC
AGGACTCTCCAGATTCAATTATGTCCTTGGGCTTGGTCGACTGCTGCAGGAGTCTTAAGGAGCCTTGTGCAAATGCTAGAGTGACTCATTTACCAACATT
AAACCCTAGGATAGATGCAACAGAGAAGTACTACTTCCTCCATGGAATGTGCTGATTTCAGGCGACGTGGCACCCAATGTAGAAAACGCTGGAATTTTTC
CTTGGAACTGGACTGTGATGAGAGGTGCTTGCCATGAACATAAGCTACTGTCTTTTTTTTCTTTTTTTGAGACGGACTTTCACTTTTTTTGCCCAGGCTG
GAGTGTAATGGCGCGATCTTGGCTCACCGCAACCTCCGCCTCCCAGGTTTGAGTGATTCTCCTACCTTAGCCTCCTGAGTAGCTGGGATTACAGGCGTGC
GCCACCATTCCCAGCTAATTTTTGTATTTTTAGTAGACACAGTGTTTCTCCATGTTGGTCAGGCTGGTCTCAAACTCCTGACCTCAGGTGATACGCCCGC
CTCAGCCTCCCAAAGTGTTGGGATTACTGGCGTGAGGCATCGTGCCCAGCAAGCTACTGTCTTTTCTTTGACCCTTTCCAGTTTTTGAAGATAAAGCAGG
AAATAATCTTCTCTGAAAGTACTTGATAAAAATTCCCAAAACAAC
In silico ORF/peptide predictions
Nothing found.
RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.