Detailed information on ENST00000459650

lncRNA-RNA interactions

Number of interactions: 36

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000394622 STEAP family member 2, metalloreductase protein coding ENST00000459650 622 303 UTR3 Trans
ENST00000470361 potassium large conductance calcium-activated channel, subfamily M, beta member 2 processed transcript ENST00000459650 575 289 noncoding Trans
ENST00000511184 E74-like factor 2 (ets domain transcription factor) nonsense mediated decay ENST00000459650 535 302 CDS_UTR Trans
ENST00000553936 gephyrin nonsense mediated decay ENST00000459650 628 288 CDS_UTR Trans
ENST00000569455 cadherin 13 processed transcript ENST00000459650 651 301 noncoding Trans
TCONS_00006081 processed_pseudogene novel protein coding ENST00000459650 612 303 UTR5 Trans
TCONS_00033132 dynein heavy chain domain 1 novel protein coding ENST00000459650 637 303 UTR5 Trans
TCONS_00034643 CD82 molecule novel protein coding ENST00000459650 615 292 UTR3 Trans
TCONS_00103261 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000459650 636 314 UTR5 Trans
TCONS_00103262 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000459650 636 314 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000459650 581 297 UTR5 Trans
TCONS_00114628 phosphoribosyl pyrophosphate synthetase-associated protein 1 novel protein coding ENST00000459650 612 300 UTR3 Trans
TCONS_00116334 low density lipoprotein receptor class A domain containing 4 novel protein coding ENST00000459650 656 293 UTR3 Trans
TCONS_00124891 zinc finger protein 540 novel protein coding ENST00000459650 642 304 UTR5 Trans
TCONS_00135631 zinc finger protein 841 novel protein coding ENST00000459650 522 300 UTR3 Trans
TCONS_00140732 NCK adaptor protein 2 novel protein coding ENST00000459650 628 294 UTR5 Trans
TCONS_00141667 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000459650 615 303 UTR3 Trans
TCONS_00141670 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000459650 615 303 UTR3 Trans
TCONS_00141673 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000459650 615 303 UTR3 Trans
TCONS_00141679 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000459650 615 303 UTR3 Trans
TCONS_00141681 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000459650 615 303 UTR3 Trans
TCONS_00147745 lincRNA novel protein coding ENST00000459650 549 275 UTR3 Trans
TCONS_00152107 cordon-bleu WH2 repeat protein-like 1 novel protein coding ENST00000459650 607 299 UTR5 Trans
TCONS_00152126 cordon-bleu WH2 repeat protein-like 1 novel protein coding ENST00000459650 607 299 UTR5 Trans
TCONS_00152127 cordon-bleu WH2 repeat protein-like 1 novel protein coding ENST00000459650 607 299 UTR5 Trans
TCONS_00168418 dual specificity phosphatase 18 novel protein coding ENST00000459650 609 284 UTR5 Trans
TCONS_00175515 transient receptor potential cation channel, subfamily C, member 1 novel protein coding ENST00000459650 639 314 UTR5 Trans
TCONS_00187460 spermatogenesis associated 18 novel protein coding ENST00000459650 628 302 UTR3 Trans
TCONS_00190999 zinc finger protein 721 novel protein coding ENST00000459650 621 290 UTR3 Trans
TCONS_00196475 F-box and leucine-rich repeat protein 7 novel protein coding ENST00000459650 601 280 UTR5 Trans
TCONS_00203197 3-oxoacid CoA transferase 1 novel protein coding ENST00000459650 628 293 UTR3 Trans
TCONS_00203198 3-oxoacid CoA transferase 1 novel protein coding ENST00000459650 628 293 UTR3 Trans
TCONS_00203663 ribosomal protein L3 pseudogene 6 novel protein coding ENST00000459650 574 288 UTR3 Trans
TCONS_00203663 ribosomal protein L3 pseudogene 6 novel protein coding ENST00000459650 602 310 UTR3 Trans
TCONS_00237103 cathepsin B novel protein coding ENST00000459650 609 291 UTR5 Trans
TCONS_00239255 tumor protein D52 novel protein coding ENST00000459650 615 301 UTR3 Trans

Sequence

>TCONS_00239255 (1638 nt)
ACCATGAAGAGTTTAATAATGAAGAGTTTCACTGCCACTTGCTTCCTTGATGAAGGTTTTACTGCCAAGGACATTCTGGACCAAAAAATTAATGAATTTT
CTTCTGATGATGATTAGGATGCCTTCTATGTCATGGACCTTAGAGACATTCTAAAGACACATCTAAGATAGTTAAAAGCTCTTCCTCATGTCACCCCCTT
TTATGCAGTCAATTATAATGACAGCAGAGCCATCATGAAGACTCTTGCTGCCATCGGGACAGGATTTGACTGTGCTAGCAAGGCTGAAATACAATTGGTG
CAGATTCTGGGGATGCCCCCAGAGAGGTTTATGTATGCAAATTCTTGTAAACAAATGTCTCAAATTAAGTACACTGCCAATAATGGAGTCCAGATGATGA
TTTTCGGTAATGAGGTCAAGTTGATGTCAGTTGCCAGAACACACTCAAAGCAGCCCGTCACATCAGTGTTAAATCTGGTGCCATGCTCAAAGCCAGCAGG
CTTCTTTTGGAATGAGCAAAAGAACTAAATATTGATGTCACTGGTGTCAGCTTCCATGTAGGAAGTAGCTGTACCAATCCTGAGACCTTCATGCAGGCAG
CCTCCAATGTCCACTGTGTCTTTGACACGGGAGTTGAGTTTGGTTTCAGAATGTAACTGCTTAATACTGGCAGTTGCTTTCCTGGATCTGAGGACGTGAG
GCTTAAATCTGAAGTATTACCAGTGTAATCAACCCAGCATCAGACAAGTATTTTCCACCAGACTCTAGAGTGAGAGTCACAGCTGAGCCAGGCAGATATT
TCATGTGGCATCAGCTTTCATTGCCAAAAAAATCATATTAAAAGAACAGACAGGGCCGTCGCGGTGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGCT
GAGGGAGATAGTTCATGAGGTCAGGAGATCAAGACCATCCTGGCTAACACGGTGAAACCCCATCTCTACTAAAAAAAAAACCCAAAAAATTAGCCAGGCA
CGGCAGCGGGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGAATGGCGTGAACCCGAGAGGCGGAGCTTGCAGTGAGCCCAGATCACACCAC
TGCACTCCAGCCTGGGTGACAGAGCGAGACTCTGTCTCAAAAAGAAAGAAAGAAAAAAAAGAACAGACAGGCTCTGAAGAGGAAGATGAGTCAAGCGAAC
AGACCTTTATGTATTACATGAATGATGAAGTATATGGATCATTTAATCAATCCTTTATGATCATGCACATGTAAAGCCCCTGCTGCAAAAGAGACCTAGA
TCAGTGAGAAGTATTATTCATCCAGTATATGGGAAGAACATGTGATGGCCTTGATCAGATTGTTGAGCACTGTGATCTGCCCAAAATATATGTAGGTAAT
TGGATGCTCTTTAAAAACATGGGCGCTGACACTGTTGCTGCTACTTGTACTTTTAATGGATTCCAGAGGCCAACAATCTACATGTGATGTCAGGACCAGC
ATCGAAACTCATGCAGTGTATCTAGAAGCACGATCTCCCACCCCAAGTAGAGGAACAGGACATTAGCATCCTGTGTCTTCTGCTTGGGAAAATAGAATGA
AACATCAATCAGCAACTTGTGCTTCTGCTAGTATTAATA

Expression



Full and truncated open reading frames discovered in TCONS_00239255

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.