Potential function | Interacting transcript | Gene description | Transcript biotype | lncRNA id | Alignment score (LAST) | Alignment length | Transcript region involved in interaction | Genomic orientation of interacting RNAs |
---|---|---|---|---|---|---|---|---|
ENST00000394622 | STEAP family member 2, metalloreductase | protein coding | ENST00000459650 | 622 | 303 | UTR3 | Trans | |
ENST00000470361 | potassium large conductance calcium-activated channel, subfamily M, beta member 2 | processed transcript | ENST00000459650 | 575 | 289 | noncoding | Trans | |
ENST00000511184 | E74-like factor 2 (ets domain transcription factor) | nonsense mediated decay | ENST00000459650 | 535 | 302 | CDS_UTR | Trans | |
ENST00000553936 | gephyrin | nonsense mediated decay | ENST00000459650 | 628 | 288 | CDS_UTR | Trans | |
ENST00000569455 | cadherin 13 | processed transcript | ENST00000459650 | 651 | 301 | noncoding | Trans | |
TCONS_00006081 | processed_pseudogene | novel protein coding | ENST00000459650 | 612 | 303 | UTR5 | Trans | |
TCONS_00033132 | dynein heavy chain domain 1 | novel protein coding | ENST00000459650 | 637 | 303 | UTR5 | Trans | |
TCONS_00034643 | CD82 molecule | novel protein coding | ENST00000459650 | 615 | 292 | UTR3 | Trans | |
TCONS_00103261 | Rap guanine nucleotide exchange factor (GEF)-like 1 | novel protein coding | ENST00000459650 | 636 | 314 | UTR5 | Trans | |
TCONS_00103262 | Rap guanine nucleotide exchange factor (GEF)-like 1 | novel protein coding | ENST00000459650 | 636 | 314 | UTR5 | Trans | |
TCONS_00109011 | trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) | novel protein coding | ENST00000459650 | 581 | 297 | UTR5 | Trans | |
TCONS_00114628 | phosphoribosyl pyrophosphate synthetase-associated protein 1 | novel protein coding | ENST00000459650 | 612 | 300 | UTR3 | Trans | |
TCONS_00116334 | low density lipoprotein receptor class A domain containing 4 | novel protein coding | ENST00000459650 | 656 | 293 | UTR3 | Trans | |
TCONS_00124891 | zinc finger protein 540 | novel protein coding | ENST00000459650 | 642 | 304 | UTR5 | Trans | |
TCONS_00135631 | zinc finger protein 841 | novel protein coding | ENST00000459650 | 522 | 300 | UTR3 | Trans | |
TCONS_00140732 | NCK adaptor protein 2 | novel protein coding | ENST00000459650 | 628 | 294 | UTR5 | Trans | |
TCONS_00141667 | Rho guanine nucleotide exchange factor (GEF) 4 | novel protein coding | ENST00000459650 | 615 | 303 | UTR3 | Trans | |
TCONS_00141670 | Rho guanine nucleotide exchange factor (GEF) 4 | novel protein coding | ENST00000459650 | 615 | 303 | UTR3 | Trans | |
TCONS_00141673 | Rho guanine nucleotide exchange factor (GEF) 4 | novel protein coding | ENST00000459650 | 615 | 303 | UTR3 | Trans | |
TCONS_00141679 | Rho guanine nucleotide exchange factor (GEF) 4 | novel protein coding | ENST00000459650 | 615 | 303 | UTR3 | Trans | |
TCONS_00141681 | Rho guanine nucleotide exchange factor (GEF) 4 | novel protein coding | ENST00000459650 | 615 | 303 | UTR3 | Trans | |
TCONS_00147745 | lincRNA | novel protein coding | ENST00000459650 | 549 | 275 | UTR3 | Trans | |
TCONS_00152107 | cordon-bleu WH2 repeat protein-like 1 | novel protein coding | ENST00000459650 | 607 | 299 | UTR5 | Trans | |
TCONS_00152126 | cordon-bleu WH2 repeat protein-like 1 | novel protein coding | ENST00000459650 | 607 | 299 | UTR5 | Trans | |
TCONS_00152127 | cordon-bleu WH2 repeat protein-like 1 | novel protein coding | ENST00000459650 | 607 | 299 | UTR5 | Trans | |
TCONS_00168418 | dual specificity phosphatase 18 | novel protein coding | ENST00000459650 | 609 | 284 | UTR5 | Trans | |
TCONS_00175515 | transient receptor potential cation channel, subfamily C, member 1 | novel protein coding | ENST00000459650 | 639 | 314 | UTR5 | Trans | |
TCONS_00187460 | spermatogenesis associated 18 | novel protein coding | ENST00000459650 | 628 | 302 | UTR3 | Trans | |
TCONS_00190999 | zinc finger protein 721 | novel protein coding | ENST00000459650 | 621 | 290 | UTR3 | Trans | |
TCONS_00196475 | F-box and leucine-rich repeat protein 7 | novel protein coding | ENST00000459650 | 601 | 280 | UTR5 | Trans | |
TCONS_00203197 | 3-oxoacid CoA transferase 1 | novel protein coding | ENST00000459650 | 628 | 293 | UTR3 | Trans | |
TCONS_00203198 | 3-oxoacid CoA transferase 1 | novel protein coding | ENST00000459650 | 628 | 293 | UTR3 | Trans | |
TCONS_00203663 | ribosomal protein L3 pseudogene 6 | novel protein coding | ENST00000459650 | 574 | 288 | UTR3 | Trans | |
TCONS_00203663 | ribosomal protein L3 pseudogene 6 | novel protein coding | ENST00000459650 | 602 | 310 | UTR3 | Trans | |
TCONS_00237103 | cathepsin B | novel protein coding | ENST00000459650 | 609 | 291 | UTR5 | Trans | |
TCONS_00239255 | tumor protein D52 | novel protein coding | ENST00000459650 | 615 | 301 | UTR3 | Trans |
>TCONS_00239255 (1638 nt)
ACCATGAAGAGTTTAATAATGAAGAGTTTCACTGCCACTTGCTTCCTTGATGAAGGTTTTACTGCCAAGGACATTCTGGACCAAAAAATTAATGAATTTT
CTTCTGATGATGATTAGGATGCCTTCTATGTCATGGACCTTAGAGACATTCTAAAGACACATCTAAGATAGTTAAAAGCTCTTCCTCATGTCACCCCCTT
TTATGCAGTCAATTATAATGACAGCAGAGCCATCATGAAGACTCTTGCTGCCATCGGGACAGGATTTGACTGTGCTAGCAAGGCTGAAATACAATTGGTG
CAGATTCTGGGGATGCCCCCAGAGAGGTTTATGTATGCAAATTCTTGTAAACAAATGTCTCAAATTAAGTACACTGCCAATAATGGAGTCCAGATGATGA
TTTTCGGTAATGAGGTCAAGTTGATGTCAGTTGCCAGAACACACTCAAAGCAGCCCGTCACATCAGTGTTAAATCTGGTGCCATGCTCAAAGCCAGCAGG
CTTCTTTTGGAATGAGCAAAAGAACTAAATATTGATGTCACTGGTGTCAGCTTCCATGTAGGAAGTAGCTGTACCAATCCTGAGACCTTCATGCAGGCAG
CCTCCAATGTCCACTGTGTCTTTGACACGGGAGTTGAGTTTGGTTTCAGAATGTAACTGCTTAATACTGGCAGTTGCTTTCCTGGATCTGAGGACGTGAG
GCTTAAATCTGAAGTATTACCAGTGTAATCAACCCAGCATCAGACAAGTATTTTCCACCAGACTCTAGAGTGAGAGTCACAGCTGAGCCAGGCAGATATT
TCATGTGGCATCAGCTTTCATTGCCAAAAAAATCATATTAAAAGAACAGACAGGGCCGTCGCGGTGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGCT
GAGGGAGATAGTTCATGAGGTCAGGAGATCAAGACCATCCTGGCTAACACGGTGAAACCCCATCTCTACTAAAAAAAAAACCCAAAAAATTAGCCAGGCA
CGGCAGCGGGCGCCTGTAGTCCCAGCTACTCGGGAGGCTGAGGCAGGAGAATGGCGTGAACCCGAGAGGCGGAGCTTGCAGTGAGCCCAGATCACACCAC
TGCACTCCAGCCTGGGTGACAGAGCGAGACTCTGTCTCAAAAAGAAAGAAAGAAAAAAAAGAACAGACAGGCTCTGAAGAGGAAGATGAGTCAAGCGAAC
AGACCTTTATGTATTACATGAATGATGAAGTATATGGATCATTTAATCAATCCTTTATGATCATGCACATGTAAAGCCCCTGCTGCAAAAGAGACCTAGA
TCAGTGAGAAGTATTATTCATCCAGTATATGGGAAGAACATGTGATGGCCTTGATCAGATTGTTGAGCACTGTGATCTGCCCAAAATATATGTAGGTAAT
TGGATGCTCTTTAAAAACATGGGCGCTGACACTGTTGCTGCTACTTGTACTTTTAATGGATTCCAGAGGCCAACAATCTACATGTGATGTCAGGACCAGC
ATCGAAACTCATGCAGTGTATCTAGAAGCACGATCTCCCACCCCAAGTAGAGGAACAGGACATTAGCATCCTGTGTCTTCTGCTTGGGAAAATAGAATGA
AACATCAATCAGCAACTTGTGCTTCTGCTAGTATTAATA
In silico ORF/peptide predictions
Nothing found.
RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.