Detailed information on ENST00000461813

lncRNA-RNA interactions

Number of interactions: 81

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000263955 serine/threonine kinase 17b protein coding ENST00000461813 608 280 UTR3 Trans
ENST00000280800 phospholipase B domain containing 2 protein coding ENST00000461813 625 263 UTR3 Trans
ENST00000312828 ring finger protein 152 protein coding ENST00000461813 623 285 UTR3 Trans
ENST00000336505 suppressor of cancer cell invasion protein coding ENST00000461813 651 282 UTR3 Trans
ENST00000359543 epithelial membrane protein 2 protein coding ENST00000461813 692 283 UTR3 Trans
ENST00000450928 antisense antisense ENST00000461813 520 285 noncoding Trans
ENST00000511184 E74-like factor 2 (ets domain transcription factor) nonsense mediated decay ENST00000461813 559 263 CDS_UTR Trans
ENST00000529743 lincRNA lincRNA ENST00000461813 605 278 noncoding Trans
ENST00000532572 protease, serine, 23 retained intron ENST00000461813 628 282 noncoding Trans
ENST00000548404 transcribed_unprocessed_pseudogene processed transcript ENST00000461813 595 275 noncoding Trans
ENST00000549365 DNA-damage regulated autophagy modulator 1 nonsense mediated decay ENST00000461813 562 259 UTR3 Trans
ENST00000556539 signal transducer and activator of transcription 2, 113kDa processed transcript ENST00000461813 684 283 noncoding Trans
ENST00000561387 ubiquitin associated protein 1-like retained intron ENST00000461813 633 280 noncoding Trans
ENST00000579685 adenomatosis polyposis coli down-regulated 1 nonsense mediated decay ENST00000461813 525 269 CDS Trans
ENST00000590442 zinc finger protein 532 retained intron ENST00000461813 640 282 noncoding Trans
ENST00000607772 CNKSR family member 3 protein coding ENST00000461813 619 282 UTR3 Trans
TCONS_00006772 lincRNA novel protein coding ENST00000461813 608 288 UTR3 Trans
TCONS_00013935 platelet-activating factor receptor novel protein coding ENST00000461813 648 282 UTR3 Trans
TCONS_00028040 ankyrin repeat domain 16 novel protein coding ENST00000461813 607 260 UTR3 Trans
TCONS_00034642 CD82 molecule novel protein coding ENST00000461813 604 283 UTR3 Trans
TCONS_00034643 CD82 molecule novel protein coding ENST00000461813 604 283 UTR3 Trans
TCONS_00039782 GRAM domain containing 1B novel protein coding ENST00000461813 634 282 UTR5 Trans
TCONS_00039782 GRAM domain containing 1B novel protein coding ENST00000461813 619 276 UTR5 Trans
TCONS_00059486 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000461813 684 283 UTR3 Trans
TCONS_00059487 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000461813 684 283 UTR3 Trans
TCONS_00059488 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000461813 684 283 UTR3 Trans
TCONS_00059489 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000461813 684 283 UTR3 Trans
TCONS_00059491 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000461813 684 283 UTR3 Trans
TCONS_00059493 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000461813 684 283 UTR3 Trans
TCONS_00059495 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000461813 684 283 UTR3 Trans
TCONS_00059497 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000461813 684 283 UTR3 Trans
TCONS_00061180 golgin A2 pseudogene 5 novel protein coding ENST00000461813 595 275 UTR5 Trans
TCONS_00065093 UBA domain containing 2 novel protein coding ENST00000461813 657 282 UTR5 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding ENST00000461813 657 282 UTR5 Trans
TCONS_00065859 ubiquitin specific peptidase 12 novel protein coding ENST00000461813 600 266 UTR3 Trans
TCONS_00067572 DCN1, defective in cullin neddylation 1, domain containing 2 novel protein coding ENST00000461813 626 260 UTR3 Trans
TCONS_00080928 SH3-domain GRB2-like 3 novel protein coding ENST00000461813 640 284 UTR5 Trans
TCONS_00095049 epithelial membrane protein 2 novel protein coding ENST00000461813 692 283 UTR3 Trans
TCONS_00095050 epithelial membrane protein 2 novel protein coding ENST00000461813 692 283 UTR3 Trans
TCONS_00095052 epithelial membrane protein 2 novel protein coding ENST00000461813 692 283 UTR3 Trans
TCONS_00099311 solute carrier family 7 (amino acid transporter light chain, L system), member 5 novel protein coding ENST00000461813 636 283 UTR5 Trans
TCONS_00099312 solute carrier family 7 (amino acid transporter light chain, L system), member 5 novel protein coding ENST00000461813 636 283 UTR5 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000461813 609 264 UTR5 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000461813 672 282 UTR5 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000461813 609 264 UTR3 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000461813 672 282 UTR3 Trans
TCONS_00108999 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000461813 615 275 UTR5 Trans
TCONS_00109000 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000461813 615 275 UTR5 Trans
TCONS_00109009 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000461813 615 275 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000461813 615 275 UTR5 Trans
TCONS_00109012 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000461813 615 275 UTR5 Trans
TCONS_00109013 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000461813 615 275 UTR5 Trans
TCONS_00109014 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000461813 615 275 UTR5 Trans
TCONS_00118919 potassium channel tetramerization domain containing 1 novel protein coding ENST00000461813 682 281 UTR3 Trans
TCONS_00119961 ring finger protein 152 novel protein coding ENST00000461813 623 285 UTR3 Trans
TCONS_00132247 zinc finger protein 43 novel noncoding ENST00000461813 659 282 noncoding Trans
TCONS_00132247 zinc finger protein 43 novel noncoding ENST00000461813 665 282 noncoding Trans
TCONS_00135884 zinc finger protein 347 novel protein coding ENST00000461813 697 283 UTR5 Trans
TCONS_00142538 antisense novel protein coding ENST00000461813 610 282 UTR3 Trans
TCONS_00143295 nucleoporin 35kDa novel protein coding ENST00000461813 628 283 UTR3 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding ENST00000461813 631 281 UTR3 Trans
TCONS_00148704 WD repeat containing planar cell polarity effector novel protein coding ENST00000461813 650 267 UTR3 Trans
TCONS_00148705 WD repeat containing planar cell polarity effector novel protein coding ENST00000461813 650 267 UTR3 Trans
TCONS_00153158 serine/threonine kinase 17b novel protein coding ENST00000461813 608 280 UTR3 Trans
TCONS_00157701 VAMP (vesicle-associated membrane protein)-associated protein B and C novel protein coding ENST00000461813 613 267 UTR5 Trans
TCONS_00165713 LIM domain kinase 2 novel protein coding ENST00000461813 614 272 UTR3 Trans
TCONS_00171146 F-box and leucine-rich repeat protein 2 novel noncoding ENST00000461813 650 283 noncoding Trans
TCONS_00174508 calcium-sensing receptor novel protein coding ENST00000461813 659 283 UTR5 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000461813 620 264 UTR3 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000461813 614 284 UTR3 Trans
TCONS_00194682 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000461813 628 283 UTR3 Trans
TCONS_00196475 F-box and leucine-rich repeat protein 7 novel protein coding ENST00000461813 600 278 UTR3 Trans
TCONS_00211226 antisense novel protein coding ENST00000461813 611 264 UTR5 Trans
TCONS_00216783 KH homology domain containing 1 novel noncoding ENST00000461813 655 280 noncoding Trans
TCONS_00230128 solute carrier family 26 (anion exchanger), member 5 novel protein coding ENST00000461813 632 283 UTR3 Trans
TCONS_00235205 epithelial splicing regulatory protein 1 novel protein coding ENST00000461813 639 282 UTR3 Trans
TCONS_00235219 epithelial splicing regulatory protein 1 novel protein coding ENST00000461813 639 282 UTR3 Trans
TCONS_00235231 epithelial splicing regulatory protein 1 novel protein coding ENST00000461813 639 282 UTR3 Trans
TCONS_00235685 oxidation resistance 1 novel protein coding ENST00000461813 608 287 UTR3 Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000461813 653 283 UTR3 Trans
TCONS_00249683 suppressor of cancer cell invasion novel protein coding ENST00000461813 651 282 UTR3 Trans

Sequence

>TCONS_00249683 (586 nt)
GTTGTGAGCTGCGGCAGAGACTGGTGGCTGGAGGAGACGCCGGCGCTGGAGAGTGCGCTGCGCCGCCCGCCGCTGAGGGACCGCGGGGTTAGCCACTGCT
GGCTGCTTCCAGTGTTCGCCGAGAGGTACCGGGGGTGACAGCTCCGGGACCGGCCGAAAGGCGAGGAACCGGAAGCCCGGGGGAGTGCGACCGCCTCAAA
TCCAGCCTTCTTGTTTGGTGGGACGACCGTCGGTTCTGTCCGGGAGGAATGACGGGGTCAAGAAATTTTACTGCAGGATAAAACTCCAGGATAAAACTGT
CAAGTGCCGGGCACGGTGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGCCGAGGCGGGCGGATCACCTGAGGTCGGGAGTTTGAGACCAGCCTGACTA
ACATGGAGAAACCCTGTCTCTGCTAAAAATACAAAATTAGCTGGGCATGGCGGCACATACGTGTAATCCCAACTACTAGGGAGGCTGAGGCAGGAGAATC
GCTTGAACCTGGGAGGCGGAGGTTGCCGTGAGCCGAGATTGCGCCATTGCACTCCAGTCTGGGCAATAAGAGCAAAACTCAGTCTCA

Expression



Full and truncated open reading frames discovered in TCONS_00249683

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.