| Potential function | Interacting transcript | Gene description | Transcript biotype | lncRNA id | Alignment score (LAST) | Alignment length | Transcript region involved in interaction | Genomic orientation of interacting RNAs |
|---|---|---|---|---|---|---|---|---|
| ENST00000482603 | glyoxylate reductase/hydroxypyruvate reductase | processed transcript | ENST00000464772 | 536 | 280 | noncoding | Trans | |
| TCONS_00023682 | pre-mRNA processing factor 18 | novel protein coding | ENST00000464772 | 616 | 272 | UTR3 | Trans | |
| TCONS_00023685 | pre-mRNA processing factor 18 | novel protein coding | ENST00000464772 | 616 | 272 | UTR3 | Trans | |
| TCONS_00023687 | pre-mRNA processing factor 18 | novel protein coding | ENST00000464772 | 616 | 272 | UTR3 | Trans | |
| TCONS_00023689 | pre-mRNA processing factor 18 | novel protein coding | ENST00000464772 | 616 | 272 | UTR3 | Trans | |
| TCONS_00141667 | Rho guanine nucleotide exchange factor (GEF) 4 | novel protein coding | ENST00000464772 | 620 | 290 | UTR3 | Trans | |
| TCONS_00141679 | Rho guanine nucleotide exchange factor (GEF) 4 | novel protein coding | ENST00000464772 | 620 | 290 | UTR3 | Trans | |
| TCONS_00150696 | septin 10 | novel protein coding | ENST00000464772 | 609 | 291 | UTR3 | Trans | |
| TCONS_00213738 | enoyl-CoA delta isomerase 2 | novel protein coding | ENST00000464772 | 601 | 288 | UTR3 | Trans | |
| TCONS_00233718 | pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2 | novel protein coding | ENST00000464772 | 601 | 288 | UTR5 | Trans | |
| TCONS_00234854 | zinc finger and BTB domain containing 10 | novel protein coding | ENST00000464772 | 618 | 289 | UTR3 | Trans | |
| TCONS_00240688 | metastasis suppressor 1 | novel protein coding | ENST00000464772 | 622 | 279 | UTR5 | Trans | |
| TCONS_00247058 | UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 | novel protein coding | ENST00000464772 | 617 | 278 | UTR3 | Trans | |
| TCONS_00251977 | G protein-coupled receptor 82 | novel protein coding | ENST00000464772 | 563 | 284 | UTR3 | Trans |
>TCONS_00251977 (572 nt)
TATGATGTAACTCATAGGCCAAAACATGGGGCATTACAGTTTTTTTGTTTTTTGAGACAGAGTCTTGCTCTGTTGCCCAGGCTGGAGTGCAGTGATGAGT
ATCTAGGCTCACTGCGACCTCTGCCTCCCGGGTTTAAGCGATTCTTCTGCTTTAGCCTCCCAAGTAGCTGGAAATACAGGTGCCCACCACCACACCCAGG
TAATTTTTGTATTTTTAGTAGAGACAGGGTTTCACCATGTTGGCCAGGCTGGTCTGGAACTCCTGACCTCAAGTGATCCGCCTGTCTCAGCCTCCCAAAG
TGCTGGGATTACAGGCATGAGCCACCACACACCCAGCCTACAGTTTTGTGCTGTGTTAACGTTATACCTATCTAGAACATTTTCAAGTAGTAGTATCATG
AAATTCTAAACGTATACTGTCTTTTAAAATGCATTTCAGTCCACCTCTGGAGGTATGAAGGAGGCTATCCAGCCCTCACAGAAGTCATGAATAAACTCAG
AGAAAATAAGGAATTTTTGGAATTTCGTAAGGCAAGAAGTGACATGCTTCTCTCCAGGAAGAATCAGCTCCTG
In silico ORF/peptide predictions
Nothing found.
RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.