Detailed information on ENST00000466550

lncRNA-RNA interactions

Number of interactions: 31

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000424496 sense_intronic sense intronic ENST00000466550 614 277 noncoding Trans
ENST00000498813 delta(4)-desaturase, sphingolipid 1 processed transcript ENST00000466550 516 272 noncoding Trans
TCONS_00004719 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 novel protein coding ENST00000466550 626 276 UTR3 Trans
TCONS_00004721 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 novel protein coding ENST00000466550 626 276 UTR3 Trans
TCONS_00028040 ankyrin repeat domain 16 novel protein coding ENST00000466550 600 276 UTR3 Trans
TCONS_00028040 ankyrin repeat domain 16 novel protein coding ENST00000466550 606 267 UTR3 Trans
TCONS_00039782 GRAM domain containing 1B novel protein coding ENST00000466550 609 267 UTR5 Trans
TCONS_00050741 spermatogenesis associated, serine-rich 2 novel protein coding ENST00000466550 616 276 UTR3 Trans
TCONS_00050741 spermatogenesis associated, serine-rich 2 novel protein coding ENST00000466550 633 276 UTR3 Trans
TCONS_00067572 DCN1, defective in cullin neddylation 1, domain containing 2 novel protein coding ENST00000466550 616 263 UTR3 Trans
TCONS_00075813 forkhead box N3 novel protein coding ENST00000466550 616 267 UTR5 Trans
TCONS_00075827 forkhead box N3 novel protein coding ENST00000466550 616 267 UTR3 Trans
TCONS_00108999 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000466550 610 260 UTR5 Trans
TCONS_00109000 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000466550 610 260 UTR5 Trans
TCONS_00109009 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000466550 610 260 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000466550 610 260 UTR5 Trans
TCONS_00109012 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000466550 610 260 UTR5 Trans
TCONS_00109013 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000466550 610 260 UTR5 Trans
TCONS_00109014 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000466550 610 260 UTR5 Trans
TCONS_00119049 GRB2 associated, regulator of MAPK1 novel protein coding ENST00000466550 639 254 UTR3 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding ENST00000466550 629 276 UTR3 Trans
TCONS_00147113 ATPase family, AAA domain containing 2B novel protein coding ENST00000466550 629 276 UTR3 Trans
TCONS_00147115 ATPase family, AAA domain containing 2B novel protein coding ENST00000466550 629 276 UTR3 Trans
TCONS_00184373 neutral cholesterol ester hydrolase 1 novel protein coding ENST00000466550 644 267 UTR3 Trans
TCONS_00190999 zinc finger protein 721 novel protein coding ENST00000466550 600 261 UTR3 Trans
TCONS_00194682 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000466550 625 270 UTR3 Trans
TCONS_00194686 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000466550 625 270 UTR3 Trans
TCONS_00222403 protein tyrosine phosphatase, non-receptor type 12 novel protein coding ENST00000466550 643 276 UTR5 Trans
TCONS_00245543 long intergenic non-protein coding RNA 963 novel protein coding ENST00000466550 629 276 UTR3 Trans
TCONS_00247576 contactin associated protein-like 3 novel protein coding ENST00000466550 608 268 UTR3 Trans
TCONS_00247594 contactin associated protein-like 3 novel protein coding ENST00000466550 608 268 UTR3 Trans

Sequence

>TCONS_00247594 (755 nt)
TAATTCGCCAAAATGACGAACACAAAGGGAAAGAGGAGAGGCACCCGATATATGTTCTCTAGGCCTTTTAGAAAACATGGAGTTGTTCCTTTGGCCACAT
ATATGCGAATCTATAAGAAAGGTGATATTGTAGACATCAAGGGAATGGGTACTGTTCAAAAAGGAATGCCCCACAAGTGTTACCATGGCAAAACTGGAAG
AGTCTACAATGTTACCCAGCATGCTGTTGGCATTGTTGTAAACAAACAAGTTAAGTAAGTAGTGTTGTAGTTCTTTGTGGCTAACCAGTATTCCCTCATA
TACCCCCTTTTCACTTTGCCAGTTGGACTTATGTCTTTATTGGTCATTCAAGTGGGGCAAAGGAAATATCCTTTTAAAACTCAGGCAAACTGGGTGTTTG
TCTGTATCCTGTCAGAGGAAACAAATTGAAATAGATTTACTGGAAAGTCTTACACAGTTAGTTACTAAGCGGTTTGTTTGTTTTGTTTCGAGACGGAGTC
TTGCTCTGTCGCCCTGGCTGGAGTGCAGTGGTGGGATCTCTGCTCTCTGCAAGCTCCACCTCCTGGGTTCACGCCATTCTCCTGCCTCAGCCTCTGGGGT
AGCTAGGACTACAGGCGCCCACCACCATGCCCAGCTAAATTTTTTGTATTCTTAGTAGAGACAGGGTTTCACTGTGTCAGCCAGGATGGTCTCAATCTCC
TGACCTCGTGATCTGCCTGCCTCGGCCTCCCAAAGTGCTGGGATTACAGGCATGAG

Expression



Full and truncated open reading frames discovered in TCONS_00247594

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.