| Potential function | Interacting transcript | Gene description | Transcript biotype | lncRNA id | Alignment score (LAST) | Alignment length | Transcript region involved in interaction | Genomic orientation of interacting RNAs |
|---|---|---|---|---|---|---|---|---|
| ENST00000261653 | syntaxin 2 | protein coding | ENST00000469873 | 502 | 298 | UTR3 | Trans | |
| ENST00000263955 | serine/threonine kinase 17b | protein coding | ENST00000469873 | 633 | 294 | UTR3 | Trans | |
| ENST00000392373 | syntaxin 2 | protein coding | ENST00000469873 | 502 | 298 | UTR3 | Trans | |
| ENST00000427746 | holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase) | protein coding | ENST00000469873 | 505 | 295 | UTR5 | Trans | |
| ENST00000450928 | antisense | antisense | ENST00000469873 | 502 | 295 | noncoding | Trans | |
| ENST00000494969 | colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) | protein coding | ENST00000469873 | 541 | 295 | CDS | Trans | |
| ENST00000521027 | pleckstrin and Sec7 domain containing 3 | protein coding | ENST00000469873 | 509 | 294 | CDS_UTR | Trans | |
| ENST00000593250 | centrosomal protein 76kDa | nonsense mediated decay | ENST00000469873 | 558 | 292 | UTR3 | Trans | |
| TCONS_00027001 | programmed cell death 4 (neoplastic transformation inhibitor) | novel protein coding | ENST00000469873 | 608 | 286 | UTR3 | Trans | |
| TCONS_00027009 | programmed cell death 4 (neoplastic transformation inhibitor) | novel protein coding | ENST00000469873 | 608 | 286 | UTR3 | Trans | |
| TCONS_00109011 | trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) | novel protein coding | ENST00000469873 | 511 | 304 | UTR5 | Trans | |
| TCONS_00119961 | ring finger protein 152 | novel protein coding | ENST00000469873 | 608 | 296 | UTR5 | Trans | |
| TCONS_00141404 | GLI family zinc finger 2 | novel protein coding | ENST00000469873 | 603 | 277 | UTR5 | Trans | |
| TCONS_00153158 | serine/threonine kinase 17b | novel protein coding | ENST00000469873 | 633 | 294 | UTR3 | Trans | |
| TCONS_00203663 | ribosomal protein L3 pseudogene 6 | novel protein coding | ENST00000469873 | 505 | 290 | UTR3 | Trans |
>TCONS_00203663 (703 nt)
GGCGTGATGGCTCACGTTGGTAGTCCTTGCACTTTGGGAGGCCAAGGCAGGTGTATCACTTGAGATCAGGGGTTCGAGTCCAGCCTGGCCAACACGGTGA
AACCCCATCTCTACTAAAAATAACAAAAAATTGCCTGACGTGGTGGCATGCACCTGTAGTCCCAGCTACTCGGGAGGCTTAGACAGGAGAATTGCTTGAA
CCCAGGAGGCAGAGGTTGCAGTGAGCTGAGATCGTGCCACTGCACTCCAGCTTGGGTGACAGAGCGAGACTCCGTCTCAAAAAAAAAAAAAAAATGGAAT
TAGTGTCTATTTTTAAAGGTCCAGTTATGTGCTCCTATAAAATTATTAAACTGTCTAGAGATCTGTTAACTAATTTATATATTTTTTTCTTTTAGGTGGG
GACCAAGGCATACTGAACACATTTTTTAGCAGCTGGGCAACAACAGATATCAGAAAACACCTGCCGTTTATTTATAACCTAAGCAGCATCTCTATATACT
CCTACCTCCCGGCATTTAAAGTGTTTGGTGCAAGTGCCAAAGTTGTGCATTTCCTGGGACGAGTCAAACCATGGAATTATACTTATGATCCCAAAACAAA
AAGTGTCAAAAGTGAGGCCCATGATCCCAACATGACTCATCCAGAGTTTCTCATCCTGTGGTGGAACATCTTTACCACCAACGTTTTACCTCTGCTTCAA
CAAT
In silico ORF/peptide predictions
Nothing found.
RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.