Detailed information on ENST00000473383

lncRNA-RNA interactions

Number of interactions: 28

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000276431 tumor necrosis factor receptor superfamily, member 10b protein coding ENST00000473383 544 277 UTR3 Trans
ENST00000338758 parvin, beta protein coding ENST00000473383 628 282 UTR3 Trans
ENST00000494969 colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) protein coding ENST00000473383 588 284 CDS Trans
ENST00000511184 E74-like factor 2 (ets domain transcription factor) nonsense mediated decay ENST00000473383 591 287 CDS_UTR Trans
ENST00000572705 transient receptor potential cation channel, subfamily V, member 1 protein coding ENST00000473383 612 280 UTR3 Trans
ENST00000593250 centrosomal protein 76kDa nonsense mediated decay ENST00000473383 551 285 UTR3 Trans
ENST00000620139 melanoregulin protein coding ENST00000473383 557 284 UTR3 Trans
TCONS_00034643 CD82 molecule novel protein coding ENST00000473383 605 282 UTR3 Trans
TCONS_00065093 UBA domain containing 2 novel protein coding ENST00000473383 660 280 UTR5 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding ENST00000473383 616 309 UTR5 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding ENST00000473383 660 280 UTR5 Trans
TCONS_00065097 UBA domain containing 2 novel protein coding ENST00000473383 616 309 UTR3 Trans
TCONS_00065103 UBA domain containing 2 novel protein coding ENST00000473383 616 309 UTR5 Trans
TCONS_00065103 UBA domain containing 2 novel protein coding ENST00000473383 660 280 UTR5 Trans
TCONS_00067572 DCN1, defective in cullin neddylation 1, domain containing 2 novel protein coding ENST00000473383 615 285 UTR3 Trans
TCONS_00070307 pecanex homolog (Drosophila) novel protein coding ENST00000473383 602 276 UTR5 Trans
TCONS_00075813 forkhead box N3 novel protein coding ENST00000473383 643 282 UTR5 Trans
TCONS_00075827 forkhead box N3 novel protein coding ENST00000473383 643 282 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000473383 612 280 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000473383 612 274 UTR5 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000473383 612 274 UTR3 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000473383 556 283 UTR5 Trans
TCONS_00109427 serine hydroxymethyltransferase 1 (soluble) novel protein coding ENST00000473383 611 282 UTR3 Trans
TCONS_00124891 zinc finger protein 540 novel protein coding ENST00000473383 618 283 UTR3 Trans
TCONS_00161618 interferon gamma receptor 2 (interferon gamma transducer 1) novel protein coding ENST00000473383 601 282 UTR3 Trans
TCONS_00190276 transmembrane protein 144 novel protein coding ENST00000473383 609 283 UTR3 Trans
TCONS_00202828 myotubularin related protein 12 novel protein coding ENST00000473383 644 283 UTR3 Trans
TCONS_00249092 transmembrane protein 245 novel protein coding ENST00000473383 605 277 UTR5 Trans

Sequence

>TCONS_00249092 (707 nt)
CGGGTGTGGTGGCTCAACGCCTGTAATCCCAGCACTTTGGGAGGCTGAGGCGGACGGATCATGAGGTCAGGAGTTCGAGACCAGCCTGACCAACATGGTA
AAACCCCGTCTCTACTAAAAATACAAAAATTAGCCGGGTCTGGTGGTGCCTGCCTGTAATCCCAGCTACTTGTGAGGCTGAGGCAGGAGAATTGCTTGAA
CCCAGGAGGCAGAGGTTGCAGTGACCCGAGATCGCACTACTGCACTCCAGCTTGGGCAACAGAGTGAGACTCAGTCTAAAAAATCATAAATAAATAATAA
AAAGAAAAGCACCTGGTTGCAGTGCTGTTAAATTGATTGAGGCCTTAAAATTTGTATTTATCATACTGAATTTATTTTGACTTTGCCTGCTATCAAATTT
TCTTTCTTGCAGTGGATTGTATTACACAGAGCATGAATATACTTCTTTAGGTTACACGCATGGGGAGATACTCTGGAGGAAGCATTTGAGCAATGTGCAA
TGGCCATGTTTGGTTACATGACAGATACTGGGACAGTGGAGCCCCTCCAAACAGTAGAAGTAGAAACCCAAGGAGATGACTTACAGTCTCTTCTGTTTCA
CTTTTTGGATGAATGGCTTTATAAGTTCAGTGCTGATGAATTCTTCATACCCCGGGAAGTGAAAGTACTTAGCATTGATCAAAGAAATTTCAAATTACGA
TCAATTGG

Expression



Full and truncated open reading frames discovered in TCONS_00249092

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.