Detailed information on ENST00000474465

lncRNA-RNA interactions

Number of interactions: 17

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000327473 tumor necrosis factor, alpha-induced protein 8-like 1 protein coding ENST00000474465 503 445 UTR3 Trans
ENST00000353047 cathepsin B protein coding ENST00000474465 774 518 UTR3 Trans
ENST00000442007 antisense antisense ENST00000474465 731 500 noncoding Trans
ENST00000621141 G protein-coupled receptor 1 protein coding ENST00000474465 507 278 UTR3 Trans
TCONS_00030588 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000474465 792 534 UTR3 Trans
TCONS_00030591 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000474465 827 495 UTR3 Trans
TCONS_00065859 ubiquitin specific peptidase 12 novel protein coding ENST00000474465 618 273 UTR3 Trans
TCONS_00103261 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000474465 625 450 UTR5 Trans
TCONS_00103262 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000474465 625 450 UTR5 Trans
TCONS_00109427 serine hydroxymethyltransferase 1 (soluble) novel protein coding ENST00000474465 648 378 UTR3 Trans
TCONS_00118582 centrosomal protein 76kDa novel protein coding ENST00000474465 836 509 UTR3 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000474465 650 525 UTR3 Trans
TCONS_00194686 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000474465 728 527 UTR3 Trans
TCONS_00237101 cathepsin B novel protein coding ENST00000474465 774 518 UTR3 Trans
TCONS_00237103 cathepsin B novel protein coding ENST00000474465 774 518 UTR3 Trans
TCONS_00243477 osteoclast stimulating factor 1 novel protein coding ENST00000474465 787 514 UTR5 Trans
TCONS_00243482 osteoclast stimulating factor 1 novel protein coding ENST00000474465 787 514 UTR5 Trans

Sequence

>TCONS_00243482 (624 nt)
TGAGGACTGACTGGGGTTCTGAGACTCCCTGTCCCGGACCGCAGCGTTAAAAGGATCTGAACAAAGTCTGCTCAAATCTCCTGCTGTGAACCAGCAGAAT
TTTTGAACAGAGTTGCACTCTTGCTGCCGAGGCTGGAGCACAATGGCGTGATCTCGGCTCACCACATCCTCTGCCTCCTGGGCTCAAGCAGTTCTGCCTC
AGCCTCCCGAGTAGCTGGGATTACAGGCATGCGCCACCACACCCCGCTAATTTTGTATTTGTAGTAGAGACAGGGTTTCTCCATGTTGGTCAGGCAGGTC
TCAAATTCCCGACCTCAGGTTATCCGCCCGCCTTGGCCTCCCAAAGTACTGGGATTACAGGCGTGAGCCACCGTGTGTGGCCTTTATTTTTATTTTTTGA
GATGGAGTTTCACTCTTGTTGCCCAGGCTGGAGTGCAATGGCACGATCTTGGCTCACTGCAACCTCCGTTTCCTGGGTTCAAGCGATTCTCCTGCCTCAG
ACTCCCGAGTAGCTGGGATTGCAGGTGTGTGCTACCACACCCGGCTAATTTTTTGTATTTTTAGTAGAGACAGGGTTTCACCATGTTGGCCAGGCTGGTC
TGGAACTCCCGACCTCAGGTGATCC

Expression



Full and truncated open reading frames discovered in TCONS_00243482

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.