Detailed information on ENST00000478443

lncRNA-RNA interactions

Number of interactions: 47

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000324537 SH3-domain GRB2-like 3 protein coding ENST00000478443 559 298 UTR5 Trans
ENST00000336824 fibronectin type III domain containing 3B protein coding ENST00000478443 594 296 UTR3 Trans
ENST00000338758 parvin, beta protein coding ENST00000478443 651 291 UTR3 Trans
ENST00000357164 GM2 ganglioside activator protein coding ENST00000478443 569 295 UTR3 Trans
ENST00000357491 zinc finger protein 43 protein coding ENST00000478443 610 292 UTR3 Trans
ENST00000448612 WD repeat domain 27 protein coding ENST00000478443 578 301 CDS Trans
ENST00000549365 DNA-damage regulated autophagy modulator 1 nonsense mediated decay ENST00000478443 523 299 CDS_UTR Trans
ENST00000550527 apoptotic peptidase activating factor 1 protein coding ENST00000478443 608 297 UTR3 Trans
ENST00000553936 gephyrin nonsense mediated decay ENST00000478443 575 297 CDS_UTR Trans
ENST00000588483 tropomyosin 4 protein coding ENST00000478443 573 294 UTR5 Trans
ENST00000594012 zinc finger protein 43 protein coding ENST00000478443 610 292 UTR3 Trans
TCONS_00034643 CD82 molecule novel protein coding ENST00000478443 600 298 UTR3 Trans
TCONS_00050195 FYVE, RhoGEF and PH domain containing 4 novel protein coding ENST00000478443 669 295 UTR5 Trans
TCONS_00050209 FYVE, RhoGEF and PH domain containing 4 novel protein coding ENST00000478443 611 255 UTR5 Trans
TCONS_00053421 apoptotic peptidase activating factor 1 novel protein coding ENST00000478443 608 297 UTR3 Trans
TCONS_00053851 transmembrane protein 263 novel protein coding ENST00000478443 642 284 UTR3 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding ENST00000478443 605 291 UTR5 Trans
TCONS_00065097 UBA domain containing 2 novel protein coding ENST00000478443 605 291 UTR3 Trans
TCONS_00065103 UBA domain containing 2 novel protein coding ENST00000478443 605 291 UTR5 Trans
TCONS_00075813 forkhead box N3 novel protein coding ENST00000478443 603 296 UTR5 Trans
TCONS_00075827 forkhead box N3 novel protein coding ENST00000478443 603 296 UTR3 Trans
TCONS_00082423 transcribed_processed_pseudogene novel protein coding ENST00000478443 602 294 UTR3 Trans
TCONS_00103261 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000478443 607 297 UTR5 Trans
TCONS_00103262 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000478443 607 297 UTR5 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000478443 600 296 UTR3 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000478443 649 295 UTR3 Trans
TCONS_00107867 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000478443 600 296 UTR3 Trans
TCONS_00107867 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000478443 649 295 UTR3 Trans
TCONS_00109427 serine hydroxymethyltransferase 1 (soluble) novel protein coding ENST00000478443 604 257 UTR3 Trans
TCONS_00119512 zinc finger and BTB domain containing 7C novel protein coding ENST00000478443 595 284 UTR3 Trans
TCONS_00124891 zinc finger protein 540 novel protein coding ENST00000478443 665 291 UTR3 Trans
TCONS_00132233 zinc finger protein 43 novel protein coding ENST00000478443 610 292 UTR3 Trans
TCONS_00159951 zinc fingers and homeoboxes 3 novel protein coding ENST00000478443 605 298 UTR5 Trans
TCONS_00161618 interferon gamma receptor 2 (interferon gamma transducer 1) novel protein coding ENST00000478443 545 295 UTR3 Trans
TCONS_00184373 neutral cholesterol ester hydrolase 1 novel protein coding ENST00000478443 615 300 UTR3 Trans
TCONS_00186316 KIAA0232 novel protein coding ENST00000478443 609 288 UTR5 Trans
TCONS_00190276 transmembrane protein 144 novel protein coding ENST00000478443 608 286 UTR3 Trans
TCONS_00200901 GM2 ganglioside activator novel protein coding ENST00000478443 569 295 UTR3 Trans
TCONS_00200902 GM2 ganglioside activator novel protein coding ENST00000478443 569 295 UTR3 Trans
TCONS_00203663 ribosomal protein L3 pseudogene 6 novel protein coding ENST00000478443 579 293 UTR3 Trans
TCONS_00225244 family with sequence similarity 115, member C novel protein coding ENST00000478443 606 290 UTR3 Trans
TCONS_00225246 family with sequence similarity 115, member C novel protein coding ENST00000478443 606 290 UTR3 Trans
TCONS_00234854 zinc finger and BTB domain containing 10 novel protein coding ENST00000478443 615 257 UTR3 Trans
TCONS_00239255 tumor protein D52 novel protein coding ENST00000478443 604 298 UTR5 Trans
TCONS_00239255 tumor protein D52 novel protein coding ENST00000478443 627 294 UTR3 Trans
TCONS_00249092 transmembrane protein 245 novel protein coding ENST00000478443 617 281 UTR5 Trans
TCONS_00252827 discs, large homolog 3 (Drosophila) novel protein coding ENST00000478443 633 296 UTR5 Trans

Sequence

>TCONS_00252827 (1070 nt)
GCCCATGAGTTTATCCTCCTCCCAAGTCCCTCAGTGACTGTGATGGTCTCCAGACTGGGAAGTCCTTGCTTGAGGAGCGCCCCTCGCCTTCCGAGTTCAC
ACACACCCCTCCCCAGGGCCACCTTGGGAGCCAGGACACGTTGGGTGTGAGCACTGCTGCTCTTGCTCCTGCCCCATCCCACCTGAGTGTCACTGTGACA
AAGGGCACAGCGGGGAAGGGATGTGGGAACGGCTTCCACCCCGGGTTGCCTCTGGAGCTGGGTGGGTGTCAGTCCTCACAGCCATTGTTTTCCCTCTGCT
TCCAGTGGAGTCTCCACCACCATCGACCCCTTCTGGGACATCAGCTTGGATCTCCCCGGCTCTTCCACCCCATTCTGGCCCCTGAGCCCAGGGAGCGAGG
GCAACGTGGTAAACGGGGAAAGCCACGTGTCGGGAACCACCACGCTCACGGACTGCCTGCGACGATTCACCAGACCAGAGCACTTGGGCAGCAGCGCCAA
GATCAAGTGCAGCGGTTGCCATAGCTACCAGGAGTCCACAAAGCAGCTCACTATGAAGAAACTGCCCATCGTAGCCTGTTTTCATCTCAAACGATTTGAA
CACTCAGCCAAGCTGCGGCGGAAGATCACCACGTATGTGTCCTTCCCCCTGGAGCTGGACATGACCCCTTTCATGGCCTCCAGGTATGTGGGGTTGTAGG
CCCGTTCTGTGTCCTGAGGGGCTGTGATCCTATCAGGACAGGAATCCAGCTCGGAGCTCCTATTAAGATGACTGTTGGCCGGGTGCAGTGGCTCCCGCCT
GTAATCCCAGCACTTCAGGAGGTCGAAGCGGGCAGATCATGAGGTCAACAGATTGAGACCATCATGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT
ACAAAAATTAGCTGGGTGTGGTGGCAGGCACCTGTAGTCCCAGCTATTTGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCAGGAGGTGGAGGTTGCAGT
GAGCCAAGATCGCGCCACTGCACTCCAGCCTGGTGACAGAACGAGACTACGTCTAAAAAAAAAAAAAAAAA

Expression



Full and truncated open reading frames discovered in TCONS_00252827

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.