Detailed information on ENST00000482943

lncRNA-RNA interactions

Number of interactions: 125

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000330676 TLC domain containing 2 protein coding ENST00000482943 637 280 UTR3 Trans
ENST00000339732 polypeptide N-acetylgalactosaminyltransferase 15 protein coding ENST00000482943 620 303 UTR3 Trans
ENST00000345714 serum/glucocorticoid regulated kinase family, member 3 protein coding ENST00000482943 617 297 UTR3 Trans
ENST00000355285 adenomatosis polyposis coli down-regulated 1 protein coding ENST00000482943 568 304 UTR3 Trans
ENST00000378004 Rho GTPase activating protein 26 protein coding ENST00000482943 641 302 UTR3 Trans
ENST00000378004 Rho GTPase activating protein 26 protein coding ENST00000482943 548 299 UTR3 Trans
ENST00000389534 zinc finger protein 841 protein coding ENST00000482943 603 280 UTR3 Trans
ENST00000391877 delta(4)-desaturase, sphingolipid 1 protein coding ENST00000482943 529 281 UTR3 Trans
ENST00000405000 pleckstrin homology domain containing, family H (with MyTH4 domain) member 2 retained intron ENST00000482943 620 302 noncoding Trans
ENST00000426391 zinc finger protein 841 protein coding ENST00000482943 603 280 UTR3 Trans
ENST00000439138 transmembrane protein 98 protein coding ENST00000482943 623 296 UTR5 Trans
ENST00000482603 glyoxylate reductase/hydroxypyruvate reductase processed transcript ENST00000482943 582 301 noncoding Trans
ENST00000498813 delta(4)-desaturase, sphingolipid 1 processed transcript ENST00000482943 622 301 noncoding Trans
ENST00000512404 glyoxylate reductase/hydroxypyruvate reductase processed transcript ENST00000482943 563 281 noncoding Trans
ENST00000513000 inositol polyphosphate-4-phosphatase, type II, 105kDa protein coding ENST00000482943 551 262 UTR3 Trans
ENST00000547865 spermatogenesis associated, serine-rich 2 protein coding ENST00000482943 604 305 UTR3 Trans
ENST00000560870 sense_intronic sense intronic ENST00000482943 613 266 noncoding Trans
ENST00000592474 phosphoribosyl pyrophosphate synthetase-associated protein 1 retained intron ENST00000482943 604 286 noncoding Trans
ENST00000593250 centrosomal protein 76kDa nonsense mediated decay ENST00000482943 621 267 UTR3 Trans
ENST00000594295 zinc finger protein 841 protein coding ENST00000482943 603 280 UTR3 Trans
ENST00000620139 melanoregulin protein coding ENST00000482943 551 306 UTR3 Trans
TCONS_00004719 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 novel protein coding ENST00000482943 621 298 UTR3 Trans
TCONS_00004721 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 novel protein coding ENST00000482943 621 298 UTR3 Trans
TCONS_00004721 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 novel protein coding ENST00000482943 602 265 UTR5 Trans
TCONS_00009834 SRY (sex determining region Y)-box 13 novel protein coding ENST00000482943 639 296 UTR3 Trans
TCONS_00010077 Ras association (RalGDS/AF-6) domain family member 5 novel protein coding ENST00000482943 648 287 UTR3 Trans
TCONS_00010841 epoxide hydrolase 1, microsomal (xenobiotic) novel protein coding ENST00000482943 574 298 UTR3 Trans
TCONS_00028040 ankyrin repeat domain 16 novel protein coding ENST00000482943 640 300 UTR3 Trans
TCONS_00028040 ankyrin repeat domain 16 novel protein coding ENST00000482943 652 286 UTR3 Trans
TCONS_00030588 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000482943 619 290 UTR3 Trans
TCONS_00030591 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000482943 605 302 UTR3 Trans
TCONS_00030591 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000482943 616 296 UTR3 Trans
TCONS_00033132 dynein heavy chain domain 1 novel protein coding ENST00000482943 612 275 UTR3 Trans
TCONS_00039782 GRAM domain containing 1B novel protein coding ENST00000482943 621 301 UTR5 Trans
TCONS_00041296 RIC3 acetylcholine receptor chaperone novel protein coding ENST00000482943 628 301 UTR5 Trans
TCONS_00041298 RIC3 acetylcholine receptor chaperone novel protein coding ENST00000482943 628 301 UTR5 Trans
TCONS_00043422 vacuolar protein sorting 37 homolog C (S. cerevisiae) novel protein coding ENST00000482943 646 299 UTR5 Trans
TCONS_00046540 sestrin 3 novel protein coding ENST00000482943 605 313 UTR5 Trans
TCONS_00050192 FYVE, RhoGEF and PH domain containing 4 novel protein coding ENST00000482943 603 297 UTR5 Trans
TCONS_00050195 FYVE, RhoGEF and PH domain containing 4 novel protein coding ENST00000482943 630 300 UTR5 Trans
TCONS_00050209 FYVE, RhoGEF and PH domain containing 4 novel protein coding ENST00000482943 603 297 UTR5 Trans
TCONS_00056991 epidermal growth factor receptor pathway substrate 8 novel protein coding ENST00000482943 554 285 UTR3 Trans
TCONS_00065103 UBA domain containing 2 novel protein coding ENST00000482943 629 298 UTR5 Trans
TCONS_00065859 ubiquitin specific peptidase 12 novel protein coding ENST00000482943 647 300 UTR3 Trans
TCONS_00065864 long intergenic non-protein coding RNA 412 novel protein coding ENST00000482943 628 297 UTR3 Trans
TCONS_00067572 DCN1, defective in cullin neddylation 1, domain containing 2 novel protein coding ENST00000482943 664 326 UTR3 Trans
TCONS_00070064 gephyrin novel protein coding ENST00000482943 601 266 UTR3 Trans
TCONS_00075827 forkhead box N3 novel protein coding ENST00000482943 600 268 UTR3 Trans
TCONS_00075844 forkhead box N3 novel protein coding ENST00000482943 553 284 UTR3 Trans
TCONS_00075845 forkhead box N3 novel protein coding ENST00000482943 553 284 UTR3 Trans
TCONS_00075917 ribosomal protein S6 kinase, 90kDa, polypeptide 5 novel noncoding ENST00000482943 603 249 noncoding Trans
TCONS_00076745 protein phosphatase 1, regulatory subunit 13B novel protein coding ENST00000482943 635 286 UTR3 Trans
TCONS_00085508 neuregulin 4 novel noncoding ENST00000482943 607 261 noncoding Trans
TCONS_00090929 nucleoporin 93kDa novel protein coding ENST00000482943 689 307 UTR3 Trans
TCONS_00090939 nucleoporin 93kDa novel protein coding ENST00000482943 651 302 UTR5 Trans
TCONS_00098643 fatty acid 2-hydroxylase novel protein coding ENST00000482943 611 289 UTR5 Trans
TCONS_00098644 fatty acid 2-hydroxylase novel protein coding ENST00000482943 611 289 UTR3 Trans
TCONS_00098645 fatty acid 2-hydroxylase novel protein coding ENST00000482943 611 289 UTR3 Trans
TCONS_00098647 fatty acid 2-hydroxylase novel protein coding ENST00000482943 611 289 UTR3 Trans
TCONS_00101146 myosin phosphatase Rho interacting protein novel protein coding ENST00000482943 555 300 UTR3 Trans
TCONS_00101169 myosin phosphatase Rho interacting protein novel protein coding ENST00000482943 532 294 UTR3 Trans
TCONS_00103261 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000482943 609 296 UTR5 Trans
TCONS_00103262 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000482943 609 296 UTR5 Trans
TCONS_00104867 hepatic leukemia factor novel protein coding ENST00000482943 625 291 UTR3 Trans
TCONS_00104871 hepatic leukemia factor novel protein coding ENST00000482943 625 291 UTR3 Trans
TCONS_00109427 serine hydroxymethyltransferase 1 (soluble) novel protein coding ENST00000482943 638 301 UTR3 Trans
TCONS_00116668 desmoglein 3 novel protein coding ENST00000482943 540 303 UTR3 Trans
TCONS_00116668 desmoglein 3 novel protein coding ENST00000482943 598 301 UTR3 Trans
TCONS_00116668 desmoglein 3 novel protein coding ENST00000482943 643 303 UTR3 Trans
TCONS_00116668 desmoglein 3 novel protein coding ENST00000482943 523 303 UTR3 Trans
TCONS_00117136 CBP80/20-dependent translation initiation factor novel protein coding ENST00000482943 560 301 UTR3 Trans
TCONS_00119478 zinc finger and BTB domain containing 7C novel protein coding ENST00000482943 621 300 UTR5 Trans
TCONS_00124891 zinc finger protein 540 novel protein coding ENST00000482943 633 278 UTR5 Trans
TCONS_00135631 zinc finger protein 841 novel protein coding ENST00000482943 603 280 UTR3 Trans
TCONS_00135644 zinc finger protein 841 novel protein coding ENST00000482943 603 280 UTR3 Trans
TCONS_00141667 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000482943 616 286 UTR3 Trans
TCONS_00141670 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000482943 644 301 UTR5 Trans
TCONS_00141673 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000482943 644 301 UTR5 Trans
TCONS_00141679 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000482943 644 301 UTR5 Trans
TCONS_00141679 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000482943 616 286 UTR3 Trans
TCONS_00142168 LY6/PLAUR domain containing 6B novel protein coding ENST00000482943 683 299 UTR5 Trans
TCONS_00148450 coiled-coil domain containing 88A novel protein coding ENST00000482943 632 301 UTR3 Trans
TCONS_00148450 coiled-coil domain containing 88A novel protein coding ENST00000482943 641 285 UTR3 Trans
TCONS_00150696 septin 10 novel protein coding ENST00000482943 614 300 UTR3 Trans
TCONS_00150696 septin 10 novel protein coding ENST00000482943 656 299 UTR3 Trans
TCONS_00161482 BTB and CNC homology 1, basic leucine zipper transcription factor 1 novel protein coding ENST00000482943 616 305 UTR3 Trans
TCONS_00163367 runt-related transcription factor 1 novel protein coding ENST00000482943 638 297 UTR3 Trans
TCONS_00182611 processed_transcript novel protein coding ENST00000482943 610 299 UTR3 Trans
TCONS_00182613 processed_transcript novel protein coding ENST00000482943 629 295 UTR5 Trans
TCONS_00182613 processed_transcript novel protein coding ENST00000482943 610 299 UTR3 Trans
TCONS_00182614 processed_transcript novel protein coding ENST00000482943 629 295 UTR5 Trans
TCONS_00182614 processed_transcript novel protein coding ENST00000482943 610 299 UTR3 Trans
TCONS_00184373 neutral cholesterol ester hydrolase 1 novel protein coding ENST00000482943 617 297 UTR3 Trans
TCONS_00185516 transcribed_unprocessed_pseudogene novel protein coding ENST00000482943 604 272 UTR5 Trans
TCONS_00185519 transcribed_unprocessed_pseudogene novel protein coding ENST00000482943 604 272 UTR3 Trans
TCONS_00186316 KIAA0232 novel protein coding ENST00000482943 634 299 UTR3 Trans
TCONS_00190999 zinc finger protein 721 novel protein coding ENST00000482943 607 285 UTR5 Trans
TCONS_00194652 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000482943 613 286 UTR5 Trans
TCONS_00194652 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000482943 603 291 UTR5 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000482943 613 286 UTR5 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000482943 603 291 UTR5 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000482943 646 290 UTR3 Trans
TCONS_00194686 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000482943 614 299 UTR3 Trans
TCONS_00194686 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000482943 601 292 UTR5 Trans
TCONS_00195633 aspartylglucosaminidase novel protein coding ENST00000482943 622 289 UTR3 Trans
TCONS_00199319 sorting nexin 24 novel noncoding ENST00000482943 634 290 noncoding Trans
TCONS_00202516 family with sequence similarity 173, member B novel protein coding ENST00000482943 640 289 UTR3 Trans
TCONS_00204911 erythrocyte membrane protein band 4.1 like 4A novel noncoding ENST00000482943 657 298 noncoding Trans
TCONS_00204916 erythrocyte membrane protein band 4.1 like 4A novel protein coding ENST00000482943 657 298 UTR3 Trans
TCONS_00213191 tubby like protein 4 novel protein coding ENST00000482943 635 288 UTR5 Trans
TCONS_00216910 high mobility group nucleosomal binding domain 3 novel noncoding ENST00000482943 650 300 noncoding Trans
TCONS_00222403 protein tyrosine phosphatase, non-receptor type 12 novel protein coding ENST00000482943 613 297 UTR5 Trans
TCONS_00233718 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2 novel protein coding ENST00000482943 617 286 UTR5 Trans
TCONS_00235281 NADH dehydrogenase (ubiquinone) complex I, assembly factor 6 novel protein coding ENST00000482943 610 273 UTR5 Trans
TCONS_00235281 NADH dehydrogenase (ubiquinone) complex I, assembly factor 6 novel protein coding ENST00000482943 639 303 UTR5 Trans
TCONS_00235685 oxidation resistance 1 novel protein coding ENST00000482943 609 300 UTR3 Trans
TCONS_00239255 tumor protein D52 novel protein coding ENST00000482943 632 300 UTR3 Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000482943 637 268 UTR5 Trans
TCONS_00240832 ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 novel protein coding ENST00000482943 620 284 UTR3 Trans
TCONS_00243477 osteoclast stimulating factor 1 novel protein coding ENST00000482943 664 297 UTR5 Trans
TCONS_00243482 osteoclast stimulating factor 1 novel protein coding ENST00000482943 664 297 UTR5 Trans
TCONS_00247058 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 novel protein coding ENST00000482943 622 290 UTR3 Trans
TCONS_00248986 transmembrane protein 246 novel protein coding ENST00000482943 574 311 UTR3 Trans
TCONS_00251977 G protein-coupled receptor 82 novel protein coding ENST00000482943 589 286 UTR3 Trans
TCONS_00252827 discs, large homolog 3 (Drosophila) novel protein coding ENST00000482943 700 306 UTR5 Trans

Sequence

>TCONS_00252827 (2522 nt)
CTCCCAGGGCATAGAATTACTGAGTTAGAAGAAATAACTGGTTTGTTTTTACATAGGATGTGATGTCTAATATTGTACTAAAAATGAGGATGCTTATGCT
ATACTCCACTGGTACTATCCACTGGATTTATTTATTTTTTTTATTTTTTGAGACGGAGTCTCGCTCTGTCGCCCAGGCTGGAGCACAGTGGTGCAAACTT
GGCTCACTGCAAGCTCTGCCTCCTGGGTTCACACCATTCTCCTGCCTCGGCCTCCAGAGTAGCTGGGACTACAGGTGCCCGCCATCACACCTGGCTAATT
TTTTTTGTATTTTTTAGTAGAGACGGGGGTTTCACCGTGTTGGCCAGGATGCCCTCGATCTTCTGACCTCATGATCCACCCGCCTCGGCCTCCCAAAATG
CTGGGATTGTAGGCGTGAGCTACCGCACCTGGCTGTTTTTGTATTTAGATAGAGTTTAAGTGCAAAGTAATCTGCTGATTTAAGGTTGTTTTAAATTCAT
ATCTGAGGAATAAAGGATGGACAGGCAATTTCCATCCCTTTGATGTTCCATAGTTCTAGCTATTTATATCATTCATTTGCCCCTTCAGCATGGATTGGCT
TACACCTGTAATACGTTCCAGAATAGCTGGATTTCTTTTGTTTTCCCATCGGTGATTTTCATAGAGTAGATGCTCAATGACATATAATGCAGAAAGGCCA
AAAATAGAGGTAAGTAAAGCTATGAAAGAAAAGAAGAACGAAAGAGGAAGCAGAGTAGTTTGATTTTGTTTATTGCTGCTTAAACCAGAGAGATATGTTA
TTCTGGAAGGGTGATTTGCTTGTTTTTACACATATGCAGCCTGACTGTTTTAGGCTTGGCTTCTTTTTTGTTTGTTTGAGATGGAGTGTCGCTCTTGTTG
CCCAGGCTGGAGTGCAGTGGCACGATCTCGGCTCACTGCAACCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCCAGTAGCTGGGATTA
CAGGTGCTCGCCACCACACCCGGCTAATTTTTACATTTTTAGTAGAGGCGGAGTTTCGCCATGTTAGCCAGGCTGGTCTTGAACTCCTGGCCTCAGGTGA
TCCACCCACTTCAGCCTCCCAAAGTGCTGGGATTACAGGTGTGAGCTATGGCACCCGGCTGGCTTATTTCTTATAGGCTTTGGGCCGTTGCTAATTTTCC
AGCTGATATAATACAATCCAGCTTTATTCGAAAGATAAGTATTCTAACTCTTGTTCGGTGTTTATTCAAACTTGTGTTTGCATGTATTTGTTTGGACTAT
AAATTTTGAGACTATAGTGAGTATGTTTTTGACTATAATATTTTAAATGGAAGATGAAATTTAAATTAGTATTTGCTTGTTTCTTTTTACAATAAAATAG
GTAGCTTTGCAGTTTGGGGAGGGCTGTTTTCCATGATTGACTGTAGTATGGTTCAAGTCAGAGGAAAGGAAGATCCCTGGAACTCCATCACAAGTGGTGC
CTTAACGGGAGCCATACTGGCAGCAAGAAATGGACCAGTGGCCATGGTTGGGTCAGCCGCAATGGGTGGCATTCTCCTAGCTTTAATTGAAGGAGCTGGT
ATCTTGTTGACAAGATTTGCCTCTGCACAGTTTCCCAATGGTCCTCAGTTTGCAGAAGACCCCTCCCAGTTGCCTTCAACTCAGTTACCTTCCTCACCTT
TTGGAGACTATCGACAATATCAGTAGGACTTCTTTCCTAGGATTTCTTTAACAGAACGAGTTGTGGTTCGAGAAGGATTTCAGAAGATCAAGTTACAGTC
TGTTTTTAAAACCATAGGTGGGACAGCTATGGCCAATAGGCTATAAAGAGACATTTAGCACTTTTTTCTATTTAAAGGAACAAGCGGGGAAGGGTGCTAA
AAGATAATACGTTTATTTATTCACACTTGAATTGCATTTGTGATCAAAATAAATGTTTAAATCGCTAAAGGAAAATACAGTAAGTGCTTGAAAGATGAAG
GACCAAAAGGCCAAAAAACAGTGAAATATGATCATCATCTCCTTGCGGACTTCTCTGCCTGGTTTTGTGTGTTCTGTTATTCAAACAATAAAAAGCTGGT
GGAACTTACTCTTTCTTTTAAGATAAGTTGTAGACTTCGATGTTTCATGCTCATGTACTTCAAATAATGCATGTTTTATAGTTAGTCCCTCATCACTTGA
AGTGACTTCTGAGAATTATGCAGAGTCAACATGGATCATTTCACAGTGAGATGCTTTATGGATTGAAGGATATGGTAAAATGTTTATAGTTTACTTTGAA
AGTAAAATATACTATGTCTTGGTTTTGAGGATATTGGATACAAAACTCTCTTCCTTTAGGGCTACTGAGTCTTGATTCCTGATCATCAGAAATTTCACCA
GAAACAACTTGCTTCCAATATACCCAATTCTATATGAAGAATTCATGGAGAGTGTACTGGCACTGGAAGAGTTTAGTGTTTCTTGTATGCTTGAAAATAA
AGTATGTACTGTTTTGAATGTGT

Expression



Full and truncated open reading frames discovered in TCONS_00252827

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.