Detailed information on ENST00000494306

lncRNA-RNA interactions

Number of interactions: 86

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000263955 serine/threonine kinase 17b protein coding ENST00000494306 641 296 UTR3 Trans
ENST00000276431 tumor necrosis factor receptor superfamily, member 10b protein coding ENST00000494306 538 251 UTR3 Trans
ENST00000336505 suppressor of cancer cell invasion protein coding ENST00000494306 639 298 UTR3 Trans
ENST00000336824 fibronectin type III domain containing 3B protein coding ENST00000494306 526 300 UTR3 Trans
ENST00000359543 epithelial membrane protein 2 protein coding ENST00000494306 672 301 UTR3 Trans
ENST00000361228 Ras association (RalGDS/AF-6) domain family (N-terminal) member 9 protein coding ENST00000494306 515 306 UTR3 Trans
ENST00000375234 AhpC/TSA antioxidant enzyme domain containing 1 protein coding ENST00000494306 610 302 UTR3 Trans
ENST00000397755 zinc finger family member 788 processed transcript ENST00000494306 562 292 noncoding Trans
ENST00000397755 zinc finger family member 788 processed transcript ENST00000494306 547 300 noncoding Trans
ENST00000397906 tetratricopeptide repeat domain 28 protein coding ENST00000494306 523 303 UTR3 Trans
ENST00000399120 holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase) protein coding ENST00000494306 548 301 UTR5 Trans
ENST00000427746 holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase) protein coding ENST00000494306 548 301 UTR5 Trans
ENST00000446045 AhpC/TSA antioxidant enzyme domain containing 1 protein coding ENST00000494306 610 302 UTR3 Trans
ENST00000494969 colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) protein coding ENST00000494306 648 297 CDS Trans
ENST00000507518 hydroxysteroid (17-beta) dehydrogenase 11 processed transcript ENST00000494306 500 221 noncoding Trans
ENST00000511184 E74-like factor 2 (ets domain transcription factor) nonsense mediated decay ENST00000494306 578 300 CDS_UTR Trans
ENST00000548404 transcribed_unprocessed_pseudogene processed transcript ENST00000494306 505 277 noncoding Trans
ENST00000553936 gephyrin nonsense mediated decay ENST00000494306 502 294 CDS_UTR Trans
ENST00000572705 transient receptor potential cation channel, subfamily V, member 1 protein coding ENST00000494306 709 301 UTR3 Trans
ENST00000620139 melanoregulin protein coding ENST00000494306 525 301 UTR3 Trans
ENST00000620788 pleckstrin homology-like domain, family B, member 1 retained intron ENST00000494306 623 303 noncoding Trans
TCONS_00023291 adenosine deaminase, RNA-specific, B2 (non-functional) novel protein coding ENST00000494306 519 259 UTR3 Trans
TCONS_00023292 adenosine deaminase, RNA-specific, B2 (non-functional) novel protein coding ENST00000494306 519 259 UTR3 Trans
TCONS_00023296 adenosine deaminase, RNA-specific, B2 (non-functional) novel protein coding ENST00000494306 519 259 UTR3 Trans
TCONS_00023298 adenosine deaminase, RNA-specific, B2 (non-functional) novel protein coding ENST00000494306 519 259 UTR3 Trans
TCONS_00025758 zinc finger, MIZ-type containing 1 novel protein coding ENST00000494306 602 303 UTR5 Trans
TCONS_00025760 zinc finger, MIZ-type containing 1 novel protein coding ENST00000494306 602 303 UTR5 Trans
TCONS_00025761 zinc finger, MIZ-type containing 1 novel protein coding ENST00000494306 602 303 UTR5 Trans
TCONS_00027001 programmed cell death 4 (neoplastic transformation inhibitor) novel protein coding ENST00000494306 611 291 UTR3 Trans
TCONS_00027009 programmed cell death 4 (neoplastic transformation inhibitor) novel protein coding ENST00000494306 611 291 UTR3 Trans
TCONS_00030130 calcium/calmodulin-dependent protein kinase II gamma novel protein coding ENST00000494306 674 285 UTR3 Trans
TCONS_00030588 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000494306 600 301 UTR3 Trans
TCONS_00034642 CD82 molecule novel protein coding ENST00000494306 609 298 UTR3 Trans
TCONS_00034643 CD82 molecule novel protein coding ENST00000494306 609 298 UTR3 Trans
TCONS_00046540 sestrin 3 novel protein coding ENST00000494306 654 300 UTR5 Trans
TCONS_00046540 sestrin 3 novel protein coding ENST00000494306 517 284 UTR3 Trans
TCONS_00061180 golgin A2 pseudogene 5 novel protein coding ENST00000494306 505 277 UTR5 Trans
TCONS_00070307 pecanex homolog (Drosophila) novel protein coding ENST00000494306 617 298 UTR5 Trans
TCONS_00080928 SH3-domain GRB2-like 3 novel protein coding ENST00000494306 663 305 UTR5 Trans
TCONS_00089066 eukaryotic elongation factor-2 kinase novel protein coding ENST00000494306 615 301 UTR3 Trans
TCONS_00095049 epithelial membrane protein 2 novel protein coding ENST00000494306 672 301 UTR3 Trans
TCONS_00095050 epithelial membrane protein 2 novel protein coding ENST00000494306 672 301 UTR3 Trans
TCONS_00095052 epithelial membrane protein 2 novel protein coding ENST00000494306 672 301 UTR3 Trans
TCONS_00098644 fatty acid 2-hydroxylase novel protein coding ENST00000494306 602 293 UTR3 Trans
TCONS_00098645 fatty acid 2-hydroxylase novel protein coding ENST00000494306 602 293 UTR3 Trans
TCONS_00098647 fatty acid 2-hydroxylase novel protein coding ENST00000494306 602 293 UTR3 Trans
TCONS_00103261 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000494306 628 301 UTR5 Trans
TCONS_00103262 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000494306 628 301 UTR5 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000494306 709 301 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000494306 634 268 UTR5 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000494306 634 268 UTR3 Trans
TCONS_00109427 serine hydroxymethyltransferase 1 (soluble) novel protein coding ENST00000494306 618 300 UTR3 Trans
TCONS_00118919 potassium channel tetramerization domain containing 1 novel protein coding ENST00000494306 671 298 UTR3 Trans
TCONS_00119512 zinc finger and BTB domain containing 7C novel protein coding ENST00000494306 606 265 UTR3 Trans
TCONS_00119961 ring finger protein 152 novel protein coding ENST00000494306 678 301 UTR5 Trans
TCONS_00135884 zinc finger protein 347 novel protein coding ENST00000494306 668 299 UTR5 Trans
TCONS_00137691 FOS-like antigen 2 novel protein coding ENST00000494306 644 290 UTR5 Trans
TCONS_00140000 long intergenic non-protein coding RNA 152 novel protein coding ENST00000494306 568 297 UTR3 Trans
TCONS_00141670 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000494306 661 299 UTR5 Trans
TCONS_00141673 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000494306 661 299 UTR5 Trans
TCONS_00141679 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000494306 661 299 UTR5 Trans
TCONS_00147093 ATPase family, AAA domain containing 2B novel protein coding ENST00000494306 631 301 UTR3 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding ENST00000494306 654 288 UTR3 Trans
TCONS_00150627 UDP-glucuronate decarboxylase 1 novel protein coding ENST00000494306 622 297 UTR5 Trans
TCONS_00153158 serine/threonine kinase 17b novel protein coding ENST00000494306 641 296 UTR3 Trans
TCONS_00157701 VAMP (vesicle-associated membrane protein)-associated protein B and C novel protein coding ENST00000494306 615 300 UTR5 Trans
TCONS_00170642 solute carrier family 6 (neurotransmitter transporter), member 6 novel protein coding ENST00000494306 580 298 UTR3 Trans
TCONS_00171146 F-box and leucine-rich repeat protein 2 novel noncoding ENST00000494306 657 284 noncoding Trans
TCONS_00175246 interleukin 20 receptor beta novel protein coding ENST00000494306 612 300 UTR5 Trans
TCONS_00185321 transferrin receptor novel protein coding ENST00000494306 645 292 UTR5 Trans
TCONS_00189916 doublecortin-like kinase 2 novel protein coding ENST00000494306 555 300 UTR3 Trans
TCONS_00189917 doublecortin-like kinase 2 novel protein coding ENST00000494306 555 300 UTR3 Trans
TCONS_00189925 doublecortin-like kinase 2 novel protein coding ENST00000494306 555 300 UTR3 Trans
TCONS_00199451 solute carrier family 12 (sodium/potassium/chloride transporter), member 2 novel protein coding ENST00000494306 607 260 UTR3 Trans
TCONS_00202516 family with sequence similarity 173, member B novel protein coding ENST00000494306 612 294 UTR5 Trans
TCONS_00202828 myotubularin related protein 12 novel protein coding ENST00000494306 627 302 UTR3 Trans
TCONS_00219475 WD repeat domain 27 novel protein coding ENST00000494306 637 303 UTR3 Trans
TCONS_00230128 solute carrier family 26 (anion exchanger), member 5 novel protein coding ENST00000494306 669 295 UTR3 Trans
TCONS_00233179 BCL2/adenovirus E1B 19kDa interacting protein 3-like novel protein coding ENST00000494306 616 300 UTR3 Trans
TCONS_00239255 tumor protein D52 novel protein coding ENST00000494306 602 300 UTR3 Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000494306 679 300 UTR3 Trans
TCONS_00242866 glyoxylate reductase/hydroxypyruvate reductase novel protein coding ENST00000494306 622 303 UTR3 Trans
TCONS_00246554 endoplasmic reticulum metallopeptidase 1 novel protein coding ENST00000494306 603 288 UTR3 Trans
TCONS_00246881 cyclin-dependent kinase inhibitor 2A novel protein coding ENST00000494306 616 300 UTR5 Trans
TCONS_00249683 suppressor of cancer cell invasion novel protein coding ENST00000494306 639 298 UTR3 Trans
TCONS_00252827 discs, large homolog 3 (Drosophila) novel protein coding ENST00000494306 600 301 UTR5 Trans

Sequence

>TCONS_00252827 (737 nt)
ACCGGGATGGGGAGGGGTCCGGCCTCCCTTCAAACCTGCGCCCACCTCAAGCAGAGTGGGTTCTACATGCTTTTAGACAAATGTCGACAAATTTGCCTCG
GTGGTTGGAGAAAGAAAAGCTCATAGGCCGGGCGCGGTGGCTCACAACTGTAATCCCAGCACTTTGGGAGGCCGAGGCGGACAGATCCCCTGAGGTCAGG
AGCTCAAGACCAGCCTGGCCAACATGGTAAAACCCCGTTTCTACTAAAAATACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAGTCCCAGCTACTC
GGGAGGCTGAGGCAGGAGAATCGCTTAAACCCGGGAGGCGGAGGTTCCCGTGAGCCAACATCGCGCCATTGCACTCCAGCCTGGGCAACAAGAGCAAAAC
TCCGTCTCAAAAAAGAAAAAAAAAGCTCCCCCGAGTGCTGCCGCTTGTGTGGATGGGTACTTGGTGGTTCTTAGGGGACCATGGATATGAGTAGCCTTTA
GGAGCTTGTGAGCCCGCTAAAACTTATACAGAAGTTTCGGGGCACCATTTTCCTTGATCATTTCTGTTTGTAGTTTTTCTATCAGTCATTTCAGTCAGCG
TCATAATTCACGTTATCTTCCTTTAGGTGGTGTTCCCACTGATGAAGAGCAGGCGACTGGGTTGGAGAGGGAGATCATGCTGGCTGCAAAGAAGGGACTG
GACCCATACAATGTACTGGCCCCAAAGGGAGCTTCAGG

Expression



Full and truncated open reading frames discovered in TCONS_00252827

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.