| Potential function | Interacting transcript | Gene description | Transcript biotype | lncRNA id | Alignment score (LAST) | Alignment length | Transcript region involved in interaction | Genomic orientation of interacting RNAs |
|---|---|---|---|---|---|---|---|---|
| ENST00000338758 | parvin, beta | protein coding | ENST00000495977 | 618 | 289 | UTR3 | Trans | |
| TCONS_00027001 | programmed cell death 4 (neoplastic transformation inhibitor) | novel protein coding | ENST00000495977 | 602 | 287 | UTR3 | Trans | |
| TCONS_00027009 | programmed cell death 4 (neoplastic transformation inhibitor) | novel protein coding | ENST00000495977 | 602 | 287 | UTR3 | Trans | |
| TCONS_00030130 | calcium/calmodulin-dependent protein kinase II gamma | novel protein coding | ENST00000495977 | 643 | 286 | UTR3 | Trans | |
| TCONS_00070307 | pecanex homolog (Drosophila) | novel protein coding | ENST00000495977 | 605 | 292 | UTR5 | Trans | |
| TCONS_00075813 | forkhead box N3 | novel protein coding | ENST00000495977 | 643 | 283 | UTR5 | Trans | |
| TCONS_00075827 | forkhead box N3 | novel protein coding | ENST00000495977 | 643 | 283 | UTR3 | Trans | |
| TCONS_00082423 | transcribed_processed_pseudogene | novel protein coding | ENST00000495977 | 517 | 286 | UTR3 | Trans | |
| TCONS_00103261 | Rap guanine nucleotide exchange factor (GEF)-like 1 | novel protein coding | ENST00000495977 | 601 | 302 | UTR5 | Trans | |
| TCONS_00103262 | Rap guanine nucleotide exchange factor (GEF)-like 1 | novel protein coding | ENST00000495977 | 601 | 302 | UTR5 | Trans | |
| TCONS_00118358 | l(3)mbt-like 4 (Drosophila) | novel protein coding | ENST00000495977 | 623 | 309 | UTR3 | Trans | |
| TCONS_00118361 | l(3)mbt-like 4 (Drosophila) | novel protein coding | ENST00000495977 | 623 | 309 | UTR3 | Trans | |
| TCONS_00119512 | zinc finger and BTB domain containing 7C | novel protein coding | ENST00000495977 | 564 | 285 | UTR3 | Trans | |
| TCONS_00123889 | ribosomal protein SA pseudogene 58 | novel protein coding | ENST00000495977 | 640 | 290 | UTR5 | Trans | |
| TCONS_00123899 | ribosomal protein SA pseudogene 58 | novel protein coding | ENST00000495977 | 640 | 290 | UTR5 | Trans | |
| TCONS_00148698 | WD repeat containing planar cell polarity effector | novel noncoding | ENST00000495977 | 615 | 271 | noncoding | Trans | |
| TCONS_00148704 | WD repeat containing planar cell polarity effector | novel protein coding | ENST00000495977 | 615 | 271 | UTR3 | Trans | |
| TCONS_00148705 | WD repeat containing planar cell polarity effector | novel protein coding | ENST00000495977 | 615 | 271 | UTR3 | Trans | |
| TCONS_00161618 | interferon gamma receptor 2 (interferon gamma transducer 1) | novel protein coding | ENST00000495977 | 616 | 285 | UTR3 | Trans | |
| TCONS_00186316 | KIAA0232 | novel protein coding | ENST00000495977 | 616 | 280 | UTR5 | Trans | |
| TCONS_00202828 | myotubularin related protein 12 | novel protein coding | ENST00000495977 | 613 | 285 | UTR3 | Trans | |
| TCONS_00234854 | zinc finger and BTB domain containing 10 | novel protein coding | ENST00000495977 | 604 | 272 | UTR3 | Trans | |
| TCONS_00239255 | tumor protein D52 | novel protein coding | ENST00000495977 | 614 | 304 | UTR5 | Trans |
>TCONS_00239255 (845 nt)
GGGAGACTGGAAGACTTGAATGAATAGGCAACCGTTCCTTCAGAGTTGATACAGCGAAGCTCCAGCACAGGTACCAGCAACTGCAGCGTCTTGTCCACCC
AGATTTCTTCAGCCAGAGGTCTCAGACTGAAAAGGACTTCTCAGAGAAGCATTCGACCCTGGTGAATGATGCCTATAAGACCCTCCTGGCCCCCCTGAGC
AGAGGACTGTACCTTGTAAGCTAAAGCTCCATGGAATAGAGATTCCTGAAAGGACAGATTATGAAATGGACAGGCAATTCCTCATAGAAATAATGGAAAT
CAATGAAAAACTCGCAGAAGCTGAAAGTGAAGCTGCCATGAAAGAGATTGAATCCATTGTCAAAGCTAAACAGAAAGAATTTACTGACAATGTGAGCAGT
GCTTTTGAACAAGATGACTTTGAAGAAGCCAAGGAAATTTTGACAAAGATGAGATACTTTTCAAATATAGAAGAAAAGATCAAGTTAAAGAAGATTCCCC
TTTAATTGTGGATAGTTTAAAGTTTAAAAAATAAAGTTCTTGCTGGGCACAGTGGCTCACACCTGTAATCCCAGCACTTTGGGAGGCTGAGGTGGGTGGA
TGACAAGGTCAGGAGTTCAAGACCAGCTTGGCCAACATAGTGAAACCCCGTCTCTGCTGAAAATACAAAAATTAGCCGGGCATGGTGGCGCGTGCCTGTA
ATCCCAGCTACTTGGTAGGCCGAGGCAGGAGAATCGCTTAAACCCGTGAGGTGGAGGTTGCAGTGAGCAGAGATCACGCAACTGCACTCCAGCTTGGGCA
ACAGAGTGAGACTTAATCTTGAAAAATAAATAAATGAAAAATAAAA
In silico ORF/peptide predictions
Nothing found.
RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.