| Potential function | Interacting transcript | Gene description | Transcript biotype | lncRNA id | Alignment score (LAST) | Alignment length | Transcript region involved in interaction | Genomic orientation of interacting RNAs |
|---|---|---|---|---|---|---|---|---|
| ENST00000263955 | serine/threonine kinase 17b | protein coding | ENST00000497739 | 596 | 296 | UTR3 | Trans | |
| ENST00000399120 | holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase) | protein coding | ENST00000497739 | 519 | 300 | UTR5 | Trans | |
| ENST00000427746 | holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase) | protein coding | ENST00000497739 | 519 | 300 | UTR5 | Trans | |
| ENST00000494969 | colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) | protein coding | ENST00000497739 | 572 | 298 | CDS | Trans | |
| ENST00000572705 | transient receptor potential cation channel, subfamily V, member 1 | protein coding | ENST00000497739 | 645 | 300 | UTR3 | Trans | |
| TCONS_00027001 | programmed cell death 4 (neoplastic transformation inhibitor) | novel protein coding | ENST00000497739 | 568 | 288 | UTR3 | Trans | |
| TCONS_00027009 | programmed cell death 4 (neoplastic transformation inhibitor) | novel protein coding | ENST00000497739 | 568 | 288 | UTR3 | Trans | |
| TCONS_00046540 | sestrin 3 | novel protein coding | ENST00000497739 | 532 | 283 | UTR3 | Trans | |
| TCONS_00065093 | UBA domain containing 2 | novel protein coding | ENST00000497739 | 631 | 296 | UTR5 | Trans | |
| TCONS_00065094 | UBA domain containing 2 | novel protein coding | ENST00000497739 | 631 | 296 | UTR5 | Trans | |
| TCONS_00067572 | DCN1, defective in cullin neddylation 1, domain containing 2 | novel protein coding | ENST00000497739 | 600 | 299 | UTR3 | Trans | |
| TCONS_00089066 | eukaryotic elongation factor-2 kinase | novel protein coding | ENST00000497739 | 611 | 297 | UTR3 | Trans | |
| TCONS_00107851 | transient receptor potential cation channel, subfamily V, member 1 | novel protein coding | ENST00000497739 | 645 | 300 | UTR3 | Trans | |
| TCONS_00109011 | trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) | novel protein coding | ENST00000497739 | 528 | 303 | UTR5 | Trans | |
| TCONS_00147093 | ATPase family, AAA domain containing 2B | novel protein coding | ENST00000497739 | 620 | 297 | UTR3 | Trans | |
| TCONS_00147093 | ATPase family, AAA domain containing 2B | novel protein coding | ENST00000497739 | 613 | 301 | UTR3 | Trans | |
| TCONS_00147100 | ATPase family, AAA domain containing 2B | novel protein coding | ENST00000497739 | 613 | 301 | UTR3 | Trans | |
| TCONS_00147106 | ATPase family, AAA domain containing 2B | novel protein coding | ENST00000497739 | 613 | 301 | UTR3 | Trans | |
| TCONS_00153158 | serine/threonine kinase 17b | novel protein coding | ENST00000497739 | 596 | 296 | UTR3 | Trans | |
| TCONS_00161482 | BTB and CNC homology 1, basic leucine zipper transcription factor 1 | novel protein coding | ENST00000497739 | 608 | 296 | UTR3 | Trans | |
| TCONS_00161618 | interferon gamma receptor 2 (interferon gamma transducer 1) | novel protein coding | ENST00000497739 | 582 | 297 | UTR3 | Trans | |
| TCONS_00168219 | THO complex 5 | novel protein coding | ENST00000497739 | 588 | 272 | UTR3 | Trans | |
| TCONS_00168220 | THO complex 5 | novel protein coding | ENST00000497739 | 588 | 272 | UTR3 | Trans | |
| TCONS_00170642 | solute carrier family 6 (neurotransmitter transporter), member 6 | novel protein coding | ENST00000497739 | 561 | 298 | UTR3 | Trans |
>TCONS_00170642 (780 nt)
GAAAGGGCCCCTGCAAGAATACTTGTTAGGTTTGCCAGCAGTAGAATCTGCATCTGGGACTGTGCCTGGAAAGGGGCACTATGGAAGGTCCCAAAATTAC
TAGCAACGATTTCAATTCAGCAAACCTTTCTGGGAAGGACACTTAGGTTGAGTAGAACATAGCATAAGAAGTGCCAATATAGCCGGGTGCAGTGACTCAC
GCCTGTAATCCCAGCACTTTGGGAGGTCCAGGCGGGCAGATCAGTTGAGGTCAGGAGTTTGAGACCAGCCTGGCCAGCATGAGAAAACCCTGTCTCTACT
AAAAATACAAAAATTAGCCAGGCATGGTGATGCACACCTGTAGTCCCAGCTACTCGGAAGGCTGAGGCACGAGAATCGCTTGAACCTGGGAGGTGGACGT
TACAGTGAGCCGAGATCACGTCACTGCACTCCAGCCTGGGCAACAAAGAGAGACCCTGTCTCAGGAAGAGAAAAAAAAAGTGCCACAACTCTACAGAAAA
AAGCCAGGTTTGGCCATCACGTTTGCAAAGCTGCCTCAAAATTTGGACAAAAACCGATATAAAGATGTGCTGCCTTATGACACCACCCGGGTATTATTGC
AGGGAAATGAAGATTATATTAATGCAAGTTACGTGAACATGGAAATTCCTGCTGCTAACCTTGTGAACAAGTACATCGCCACTCAGGGGCCCCTGCCGCA
TACCTGTGCACAGTTTTGGCAGGTTGTCTGGGATCAGAAGTTGTCACTCATTGTCATGTTGACGACTCTCACAGAACGAGG
In silico ORF/peptide predictions
Nothing found.
RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.