Detailed information on ENST00000498401

lncRNA-RNA interactions

Number of interactions: 46

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000323816 growth arrest-specific 7 protein coding ENST00000498401 519 296 UTR3 Trans
ENST00000336787 RAB27A, member RAS oncogene family protein coding ENST00000498401 718 309 UTR3 Trans
ENST00000382142 myotubularin related protein 12 protein coding ENST00000498401 502 297 UTR3 Trans
ENST00000396307 RAB27A, member RAS oncogene family protein coding ENST00000498401 718 309 UTR3 Trans
ENST00000424496 sense_intronic sense intronic ENST00000498401 559 293 noncoding Trans
ENST00000437099 growth arrest-specific 7 protein coding ENST00000498401 519 296 UTR3 Trans
ENST00000547865 spermatogenesis associated, serine-rich 2 protein coding ENST00000498401 702 308 UTR3 Trans
ENST00000620139 melanoregulin protein coding ENST00000498401 510 309 UTR3 Trans
TCONS_00001594 lincRNA novel protein coding ENST00000498401 648 301 UTR5 Trans
TCONS_00021902 protein tyrosine phosphatase, non-receptor type 14 novel protein coding ENST00000498401 514 254 UTR3 Trans
TCONS_00021903 protein tyrosine phosphatase, non-receptor type 14 novel protein coding ENST00000498401 514 254 UTR3 Trans
TCONS_00030130 calcium/calmodulin-dependent protein kinase II gamma novel protein coding ENST00000498401 687 307 UTR3 Trans
TCONS_00030588 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000498401 601 299 UTR3 Trans
TCONS_00037377 NAD synthetase 1 novel protein coding ENST00000498401 615 309 UTR5 Trans
TCONS_00039782 GRAM domain containing 1B novel protein coding ENST00000498401 615 311 UTR5 Trans
TCONS_00050741 spermatogenesis associated, serine-rich 2 novel protein coding ENST00000498401 617 309 UTR3 Trans
TCONS_00067572 DCN1, defective in cullin neddylation 1, domain containing 2 novel protein coding ENST00000498401 620 303 UTR3 Trans
TCONS_00083866 RAB27A, member RAS oncogene family novel protein coding ENST00000498401 718 309 UTR3 Trans
TCONS_00090929 nucleoporin 93kDa novel protein coding ENST00000498401 644 311 UTR3 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000498401 636 303 UTR3 Trans
TCONS_00107867 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000498401 636 303 UTR3 Trans
TCONS_00116668 desmoglein 3 novel protein coding ENST00000498401 549 317 UTR3 Trans
TCONS_00116668 desmoglein 3 novel protein coding ENST00000498401 579 308 UTR3 Trans
TCONS_00141670 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000498401 628 303 UTR5 Trans
TCONS_00141673 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000498401 628 303 UTR5 Trans
TCONS_00141679 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000498401 628 303 UTR5 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding ENST00000498401 615 310 UTR3 Trans
TCONS_00147113 ATPase family, AAA domain containing 2B novel protein coding ENST00000498401 615 310 UTR3 Trans
TCONS_00147115 ATPase family, AAA domain containing 2B novel protein coding ENST00000498401 615 310 UTR3 Trans
TCONS_00165085 SPECC1L-ADORA2A readthrough (NMD candidate) novel protein coding ENST00000498401 606 309 UTR3 Trans
TCONS_00165089 SPECC1L-ADORA2A readthrough (NMD candidate) novel protein coding ENST00000498401 606 309 UTR3 Trans
TCONS_00165090 SPECC1L-ADORA2A readthrough (NMD candidate) novel protein coding ENST00000498401 606 309 UTR3 Trans
TCONS_00165341 TTC28 antisense RNA 1 novel protein coding ENST00000498401 616 306 UTR5 Trans
TCONS_00184373 neutral cholesterol ester hydrolase 1 novel protein coding ENST00000498401 605 304 UTR3 Trans
TCONS_00190799 sorting nexin 25 novel protein coding ENST00000498401 606 304 UTR3 Trans
TCONS_00194682 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000498401 648 308 UTR3 Trans
TCONS_00194686 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000498401 617 288 UTR3 Trans
TCONS_00194686 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000498401 648 308 UTR3 Trans
TCONS_00213181 tubby like protein 4 novel protein coding ENST00000498401 633 303 UTR3 Trans
TCONS_00213191 tubby like protein 4 novel protein coding ENST00000498401 633 303 UTR3 Trans
TCONS_00222403 protein tyrosine phosphatase, non-receptor type 12 novel protein coding ENST00000498401 638 301 UTR5 Trans
TCONS_00235281 NADH dehydrogenase (ubiquinone) complex I, assembly factor 6 novel protein coding ENST00000498401 614 302 UTR5 Trans
TCONS_00235708 oxidation resistance 1 novel protein coding ENST00000498401 638 297 UTR3 Trans
TCONS_00239255 tumor protein D52 novel protein coding ENST00000498401 615 303 UTR3 Trans
TCONS_00253752 queuine tRNA-ribosyltransferase 1 pseudogene 1 novel protein coding ENST00000498401 583 280 UTR3 Trans
TCONS_00256068 shroom family member 4 novel protein coding ENST00000498401 626 303 UTR3 Trans

Sequence

>TCONS_00256068 (957 nt)
CTGGGCTGCCTGGACAAGAACATGAAAATCAAGTCCCTGGAGCAGATCTCTCTCTTCTCCCTGCCCATCAAGGAATCTGAGATCATCGACATTTCTGGGG
ACACCCTCTCACAGGTGAGGTTTTGAAGACTATACTTGTGGCAAAAGCAGACCCACACTGGCCAGTGGACCAGGTTCAAGGCATTTGTTACCATAAGGGA
CTACAATGGCTACATCAGTCTGGATAATTGCTCCAAGGAGGCGGACAGTAGCATCTGTGGGGTTATCACCCTGCTCTCCATCATCCCCATGCAGCAAGGA
TCCAATGGAACAAGATCAGCAAGCTCCACACTCTGCACTGCAAGTGACTGGCTGCTGCGGCTCTGTGCTGATGTGCCTCACCCTCGCCCCCAAAGGCACT
GTCAACATCTTAGGTCCTGCACTCAAAAAGCTGCTGCTTATACCTGGTACTCATGACTGCTACACCTTAGCCAGGGGTTGCACCACCCTCTGAGCAACTG
TGCCAAGACTACCTTTGATGCCACCTCCAAGATCTTTTTGTTTTTTTTTTTTTGAGACGGAGTCTCGCTCCATCACCCAGGATGGAGTGCAGTGGCACGA
TCTCGGCTCACTGCAAGCTCCGCCTCCAGGGTTCACGTCATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGACTACAGGTGTCCACCACCACACACAGCT
AATTTTTTTTTTTTTTCTATTTTTAGTAGAGATGGAGTTTCACTGTGTTAGCCAGGATGGTCTCGATCTCCTGACCTCATGATCCACCCACCTTGGCCTC
CCAAAGTGCTGGGATTACAGGTGTGAGCCACCACGCCCAGCCGCCACCTCCAAGATCTTTAGCTATCTGACCTCTTACTTCTGGAAAGATTGTGTTTACC
AAATCACCTAATTGGGAATTCACTGGCCATCTAGTAAAGACCTGCACCAGAGCCTCTG

Expression



Full and truncated open reading frames discovered in TCONS_00256068

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.