Detailed information on ENST00000504230

lncRNA-RNA interactions

Number of interactions: 58

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000276431 tumor necrosis factor receptor superfamily, member 10b protein coding ENST00000504230 534 252 UTR3 Trans
ENST00000336505 suppressor of cancer cell invasion protein coding ENST00000504230 611 290 UTR3 Trans
ENST00000368324 synaptotagmin XI protein coding ENST00000504230 606 290 UTR3 Trans
ENST00000494969 colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) protein coding ENST00000504230 629 288 CDS Trans
ENST00000498535 makorin ring finger protein 1 nonsense mediated decay ENST00000504230 569 265 CDS Trans
ENST00000517408 antisense antisense ENST00000504230 512 298 noncoding Trans
ENST00000549365 DNA-damage regulated autophagy modulator 1 nonsense mediated decay ENST00000504230 557 259 UTR3 Trans
ENST00000556539 signal transducer and activator of transcription 2, 113kDa processed transcript ENST00000504230 623 290 noncoding Trans
ENST00000572705 transient receptor potential cation channel, subfamily V, member 1 protein coding ENST00000504230 545 298 UTR3 Trans
ENST00000572705 transient receptor potential cation channel, subfamily V, member 1 protein coding ENST00000504230 649 277 UTR3 Trans
ENST00000593250 centrosomal protein 76kDa nonsense mediated decay ENST00000504230 518 262 UTR3 Trans
ENST00000620139 melanoregulin protein coding ENST00000504230 551 290 UTR3 Trans
TCONS_00030130 calcium/calmodulin-dependent protein kinase II gamma novel protein coding ENST00000504230 643 292 UTR3 Trans
TCONS_00032151 long intergenic non-protein coding RNA 959 novel protein coding ENST00000504230 549 265 UTR5 Trans
TCONS_00059486 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000504230 623 290 UTR3 Trans
TCONS_00059487 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000504230 623 290 UTR3 Trans
TCONS_00059488 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000504230 623 290 UTR3 Trans
TCONS_00059489 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000504230 623 290 UTR3 Trans
TCONS_00059491 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000504230 623 290 UTR3 Trans
TCONS_00059493 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000504230 623 290 UTR3 Trans
TCONS_00059495 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000504230 623 290 UTR3 Trans
TCONS_00059497 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000504230 623 290 UTR3 Trans
TCONS_00061168 UHRF1 binding protein 1-like novel protein coding ENST00000504230 601 290 UTR3 Trans
TCONS_00067572 DCN1, defective in cullin neddylation 1, domain containing 2 novel protein coding ENST00000504230 618 290 UTR3 Trans
TCONS_00070307 pecanex homolog (Drosophila) novel protein coding ENST00000504230 608 286 UTR5 Trans
TCONS_00080928 SH3-domain GRB2-like 3 novel protein coding ENST00000504230 618 276 UTR5 Trans
TCONS_00099311 solute carrier family 7 (amino acid transporter light chain, L system), member 5 novel protein coding ENST00000504230 607 289 UTR5 Trans
TCONS_00099312 solute carrier family 7 (amino acid transporter light chain, L system), member 5 novel protein coding ENST00000504230 607 289 UTR5 Trans
TCONS_00103261 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000504230 622 290 UTR5 Trans
TCONS_00103262 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000504230 622 290 UTR5 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000504230 545 298 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000504230 649 277 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000504230 618 265 UTR5 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000504230 618 265 UTR3 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000504230 555 289 UTR5 Trans
TCONS_00118919 potassium channel tetramerization domain containing 1 novel protein coding ENST00000504230 668 290 UTR3 Trans
TCONS_00119961 ring finger protein 152 novel protein coding ENST00000504230 690 290 UTR5 Trans
TCONS_00123889 ribosomal protein SA pseudogene 58 novel protein coding ENST00000504230 631 287 UTR5 Trans
TCONS_00123899 ribosomal protein SA pseudogene 58 novel protein coding ENST00000504230 631 287 UTR5 Trans
TCONS_00135884 zinc finger protein 347 novel protein coding ENST00000504230 598 286 UTR5 Trans
TCONS_00137691 FOS-like antigen 2 novel protein coding ENST00000504230 625 290 UTR5 Trans
TCONS_00141670 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000504230 602 298 UTR5 Trans
TCONS_00141673 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000504230 602 298 UTR5 Trans
TCONS_00141679 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000504230 602 298 UTR5 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding ENST00000504230 601 277 UTR3 Trans
TCONS_00150627 UDP-glucuronate decarboxylase 1 novel protein coding ENST00000504230 602 282 UTR5 Trans
TCONS_00175246 interleukin 20 receptor beta novel protein coding ENST00000504230 600 292 UTR5 Trans
TCONS_00185321 transferrin receptor novel protein coding ENST00000504230 600 290 UTR5 Trans
TCONS_00187165 NEDD4 binding protein 2 novel protein coding ENST00000504230 621 291 UTR3 Trans
TCONS_00196475 F-box and leucine-rich repeat protein 7 novel protein coding ENST00000504230 577 297 UTR3 Trans
TCONS_00200901 GM2 ganglioside activator novel protein coding ENST00000504230 612 290 UTR3 Trans
TCONS_00200902 GM2 ganglioside activator novel protein coding ENST00000504230 612 290 UTR3 Trans
TCONS_00230128 solute carrier family 26 (anion exchanger), member 5 novel protein coding ENST00000504230 610 276 UTR3 Trans
TCONS_00233718 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2 novel protein coding ENST00000504230 605 277 UTR5 Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000504230 643 291 UTR3 Trans
TCONS_00243477 osteoclast stimulating factor 1 novel protein coding ENST00000504230 602 262 UTR5 Trans
TCONS_00243482 osteoclast stimulating factor 1 novel protein coding ENST00000504230 602 262 UTR5 Trans
TCONS_00249683 suppressor of cancer cell invasion novel protein coding ENST00000504230 611 290 UTR3 Trans

Sequence

>TCONS_00249683 (1557 nt)
CTCTCTCTCTCTCTCCTGCTGCATTGTGAAGAAACTGCTTGCTTCCCTCTCACCCTCTGCAGTTTCCTGAGGCCTCCCCAGCCATGCGGAACGCTGTAGA
CCAAGACCTGGAATTAACACATCAGAAGATTCTATGAGGAAACCCATTTAAAAATAGGATGCATTTTTTTCTTTTCTGCACAGGGAGAAAGTTTAAGCTC
TCCTCACTATGAGTTTTCAAGTATAAAAGACTTTTTCTTCCACGATTTTGAGAACAACTGAGGACTCTTGTGACCAGGACAACAGGGAAGCTTGCAGCAA
GATAGCTCCAGGTTGGATTCATGCTTCGCACCCCAAGGGCTGCCAGCCAGAGAGGAGGAGAAGCAATCACTCCTGCAGTTTCTGAACACTACACAGACGC
CAGGTAGCTTCTTCAGGAGAACAGCCCTCTGAGGAGGCAGGAAGAGGAGGCTTATCTTTCAGCAGCCGGAGCTGCTGAGATCTCTGGGCAGATTAAGCTC
TCTCTAATGGATGGGCTCCAGCCTGGCACATTCAGTGGAGAGGGATCCACTCATCCATCATCAACATAATATGGTCCTCCCTGCACTTCACAGTGTCCTC
TTGCTATTGAAAAGGCTTTTTTGCCTTCTCAAGTTTCTTTGTCAACAGTCTACAGGAAGAAGCTCAGGCCGCCACCGGCAGAGGTGAATGCAAGCTCACG
TTTTATTTCTGACTGCTTAATCATTGCCTCGATCACTGCTCAAGCTCTGCCTTTGTTTCCAAAGGTTACCTGTGGGAAAACTTCTTTTTCTATGCTGAAA
TTAATAGGGAGGCAAAGATGAGTCCACTGATAAGCAGAGCCTTAAAACTCACATAGAGAAACAACTTTGCTGGAGTGTGTGTGAGTGAACCACTAAGGAA
TCAGATAGTGTGATGGCAGTTATCATTGCAGGTTAAGACATTTCTACAAATATTTCGACATCTCCATATACTCACTCCTTTCCCCCCTGAGTGGAGAGAC
TCAGCTACCAAGAGAGGAAGCTCAAAAAAAACAGAAGCTTCAAACAAACAACCAACCAAAAAAAAAAAAAAACTGTGGGTTCATCAGAGGTGGTAGGGAA
GACAAAAACATGGGAGGAGCAGCTGGGCACGGTGGCTCAAGCCTGTAATCCCAGCACTTTGCGAGGCTGAGGTGGGTGGATCACCTGAGGTCAGGAGTTC
GAGACCAGCCTGGCCAACATGGTGAAACCCCATCTCTACTAAAAATACAAAAAATTAGCCGGGCGTTGTGGTACGCACCTGTAATCCCAGCTACTCCGGA
GGCTGAGGCAGCAGAATCGCTTGAACCCAGGAGGCAGAGGTTGCAACGAGCCAAGATCGCACCATTGCACTCCAGCCTGGGCAACAAGAGCGAAACTCCA
TCTAAAAAAAACAAACAAGCAAACAAACAAAAAACACGGGAGGAGCAATAAAAAGGAATCCATGCTTTGATTTTTTTTTTTAGTGAGAGGAAGGGAAGGC
TGCTGCCTCTCACTTCTCCCTGTTTTGTTGTTCTTTTAAGTAGCATGTGTCACTCTGT

Expression



Full and truncated open reading frames discovered in TCONS_00249683

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.