Detailed information on ENST00000504242

lncRNA-RNA interactions

Number of interactions: 49

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000299157 IKBKB interacting protein protein coding ENST00000504242 577 270 UTR3 Trans
ENST00000336787 RAB27A, member RAS oncogene family protein coding ENST00000504242 606 274 UTR3 Trans
ENST00000396307 RAB27A, member RAS oncogene family protein coding ENST00000504242 606 274 UTR3 Trans
ENST00000498813 delta(4)-desaturase, sphingolipid 1 processed transcript ENST00000504242 503 267 noncoding Trans
ENST00000607772 CNKSR family member 3 protein coding ENST00000504242 623 278 UTR3 Trans
TCONS_00001594 lincRNA novel protein coding ENST00000504242 660 272 UTR5 Trans
TCONS_00021902 protein tyrosine phosphatase, non-receptor type 14 novel protein coding ENST00000504242 574 255 UTR3 Trans
TCONS_00021903 protein tyrosine phosphatase, non-receptor type 14 novel protein coding ENST00000504242 574 255 UTR3 Trans
TCONS_00030588 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000504242 628 282 UTR3 Trans
TCONS_00039782 GRAM domain containing 1B novel protein coding ENST00000504242 631 268 UTR5 Trans
TCONS_00041296 RIC3 acetylcholine receptor chaperone novel protein coding ENST00000504242 635 268 UTR3 Trans
TCONS_00041298 RIC3 acetylcholine receptor chaperone novel protein coding ENST00000504242 635 268 UTR3 Trans
TCONS_00046540 sestrin 3 novel protein coding ENST00000504242 617 269 UTR5 Trans
TCONS_00050741 spermatogenesis associated, serine-rich 2 novel protein coding ENST00000504242 649 269 UTR3 Trans
TCONS_00050741 spermatogenesis associated, serine-rich 2 novel protein coding ENST00000504242 606 277 UTR3 Trans
TCONS_00050741 spermatogenesis associated, serine-rich 2 novel protein coding ENST00000504242 632 267 UTR3 Trans
TCONS_00067572 DCN1, defective in cullin neddylation 1, domain containing 2 novel protein coding ENST00000504242 680 269 UTR3 Trans
TCONS_00083866 RAB27A, member RAS oncogene family novel protein coding ENST00000504242 606 274 UTR3 Trans
TCONS_00088441 antisense novel protein coding ENST00000504242 837 405 UTR3 Trans
TCONS_00090939 nucleoporin 93kDa novel protein coding ENST00000504242 602 268 UTR5 Trans
TCONS_00108999 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000504242 624 268 UTR5 Trans
TCONS_00109000 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000504242 624 268 UTR5 Trans
TCONS_00109009 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000504242 624 268 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000504242 624 268 UTR5 Trans
TCONS_00109012 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000504242 624 268 UTR5 Trans
TCONS_00109013 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000504242 624 268 UTR5 Trans
TCONS_00109014 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000504242 624 268 UTR5 Trans
TCONS_00109427 serine hydroxymethyltransferase 1 (soluble) novel protein coding ENST00000504242 615 268 UTR3 Trans
TCONS_00116668 desmoglein 3 novel protein coding ENST00000504242 589 256 UTR3 Trans
TCONS_00116668 desmoglein 3 novel protein coding ENST00000504242 603 268 UTR3 Trans
TCONS_00118919 potassium channel tetramerization domain containing 1 novel protein coding ENST00000504242 619 268 UTR3 Trans
TCONS_00119049 GRB2 associated, regulator of MAPK1 novel protein coding ENST00000504242 606 269 UTR3 Trans
TCONS_00133831 carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) novel protein coding ENST00000504242 601 270 UTR3 Trans
TCONS_00141670 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000504242 629 268 UTR5 Trans
TCONS_00141673 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000504242 629 268 UTR5 Trans
TCONS_00141679 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000504242 629 268 UTR5 Trans
TCONS_00150696 septin 10 novel protein coding ENST00000504242 630 269 UTR3 Trans
TCONS_00184373 neutral cholesterol ester hydrolase 1 novel protein coding ENST00000504242 674 267 UTR3 Trans
TCONS_00194652 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000504242 609 282 UTR5 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000504242 609 282 UTR5 Trans
TCONS_00194682 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000504242 630 270 UTR3 Trans
TCONS_00194686 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000504242 630 270 UTR3 Trans
TCONS_00222403 protein tyrosine phosphatase, non-receptor type 12 novel protein coding ENST00000504242 634 273 UTR5 Trans
TCONS_00226753 cell division cycle associated 7-like novel protein coding ENST00000504242 625 285 UTR3 Trans
TCONS_00235708 oxidation resistance 1 novel protein coding ENST00000504242 607 270 UTR3 Trans
TCONS_00235708 oxidation resistance 1 novel protein coding ENST00000504242 827 399 UTR3 Trans
TCONS_00239255 tumor protein D52 novel protein coding ENST00000504242 624 271 UTR3 Trans
TCONS_00247576 contactin associated protein-like 3 novel protein coding ENST00000504242 616 259 UTR3 Trans
TCONS_00247594 contactin associated protein-like 3 novel protein coding ENST00000504242 616 259 UTR3 Trans

Sequence

>TCONS_00247594 (675 nt)
ACGGCAGCCATCGCGCTTTGCAGTTCGGTCTCCTGGTGTACGGCCAACGCCAAGTAGGGGATTGCGTTCCCTCCAGTCGCAGAGTTTCCCTCTTGTCGCC
CAGGCTGGAGTGAAGTGGCACGATCTCGGCTTACTGCAAGCTCCGCCTCCCGGGTTCACGCCATTCTCCTGCCTCAGCCTCCCGAGTAGCTGGGACTACA
GGTGCCCGCCACCACGCACCGCTAATTTTTTTGTATTTTTTAGTAGAGATGGGGTTTCACCGTGTTAGCCAGGATGGTCTCTTATCTCCTGACCTCGTGA
TCCGCCTGCCTCGGCCTCCCAAAGTGCTGGGATTATAGGCGTGAGCCACCGCATCCGGTCTAACTTTTCTATTTTTAGTAGAGATGGGATTTCTCTATGT
TGGCCAGTCTGGTCTCCAACTCCTGACCTCAGGTGATCTGCTCGCCTCGGCCTCCCAAAGTGCTGGGATTAAAGGCATGAGCCACCTCAGTGGGCCACTG
TACTGATTTTTAAGGTGTTGAAGCTTTTCCAAGAAGATTTGTTTTAAAACAGCTAAAACTTTGACATTGTTAGCTGAAAGAACCAAATTCGTCAGCAATT
TAAGGTGTTTGGTACAGTGGACAAAATGAGGTGAAGAAGTCCTTTTAACTTGAAAAATTAAACATAGTATTATTTA

Expression



Full and truncated open reading frames discovered in TCONS_00247594

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.