Detailed information on ENST00000505341

lncRNA-RNA interactions

Number of interactions: 72

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000280800 phospholipase B domain containing 2 protein coding ENST00000505341 609 284 UTR3 Trans
ENST00000336505 suppressor of cancer cell invasion protein coding ENST00000505341 661 264 UTR3 Trans
ENST00000359543 epithelial membrane protein 2 protein coding ENST00000505341 658 279 UTR3 Trans
ENST00000498535 makorin ring finger protein 1 nonsense mediated decay ENST00000505341 545 269 CDS Trans
ENST00000524264 SAP30L antisense RNA 1 (head to head) antisense ENST00000505341 657 277 noncoding Trans
ENST00000532572 protease, serine, 23 retained intron ENST00000505341 617 277 noncoding Trans
ENST00000548404 transcribed_unprocessed_pseudogene processed transcript ENST00000505341 609 277 noncoding Trans
ENST00000556539 signal transducer and activator of transcription 2, 113kDa processed transcript ENST00000505341 657 276 noncoding Trans
ENST00000561387 ubiquitin associated protein 1-like retained intron ENST00000505341 608 278 noncoding Trans
ENST00000572705 transient receptor potential cation channel, subfamily V, member 1 protein coding ENST00000505341 531 298 UTR3 Trans
ENST00000572705 transient receptor potential cation channel, subfamily V, member 1 protein coding ENST00000505341 654 280 UTR3 Trans
ENST00000587344 sense_intronic sense intronic ENST00000505341 605 277 noncoding Trans
ENST00000607772 CNKSR family member 3 protein coding ENST00000505341 641 278 UTR3 Trans
TCONS_00006772 lincRNA novel protein coding ENST00000505341 618 284 UTR3 Trans
TCONS_00023682 pre-mRNA processing factor 18 novel protein coding ENST00000505341 625 259 UTR3 Trans
TCONS_00023685 pre-mRNA processing factor 18 novel protein coding ENST00000505341 625 259 UTR3 Trans
TCONS_00023687 pre-mRNA processing factor 18 novel protein coding ENST00000505341 625 259 UTR3 Trans
TCONS_00023689 pre-mRNA processing factor 18 novel protein coding ENST00000505341 625 259 UTR3 Trans
TCONS_00034643 CD82 molecule novel protein coding ENST00000505341 625 265 UTR3 Trans
TCONS_00059486 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000505341 657 276 UTR3 Trans
TCONS_00059487 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000505341 657 276 UTR3 Trans
TCONS_00059488 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000505341 657 276 UTR3 Trans
TCONS_00059489 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000505341 657 276 UTR3 Trans
TCONS_00059491 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000505341 657 276 UTR3 Trans
TCONS_00059493 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000505341 657 276 UTR3 Trans
TCONS_00059495 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000505341 657 276 UTR3 Trans
TCONS_00059497 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000505341 657 276 UTR3 Trans
TCONS_00061180 golgin A2 pseudogene 5 novel protein coding ENST00000505341 609 277 UTR5 Trans
TCONS_00065093 UBA domain containing 2 novel protein coding ENST00000505341 673 277 UTR5 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding ENST00000505341 673 277 UTR5 Trans
TCONS_00065859 ubiquitin specific peptidase 12 novel protein coding ENST00000505341 614 268 UTR3 Trans
TCONS_00067572 DCN1, defective in cullin neddylation 1, domain containing 2 novel protein coding ENST00000505341 635 265 UTR3 Trans
TCONS_00070307 pecanex homolog (Drosophila) novel protein coding ENST00000505341 656 278 UTR5 Trans
TCONS_00095049 epithelial membrane protein 2 novel protein coding ENST00000505341 658 279 UTR3 Trans
TCONS_00095050 epithelial membrane protein 2 novel protein coding ENST00000505341 658 279 UTR3 Trans
TCONS_00095052 epithelial membrane protein 2 novel protein coding ENST00000505341 658 279 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000505341 629 280 UTR5 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000505341 531 298 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000505341 654 280 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000505341 603 266 UTR5 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000505341 660 277 UTR5 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000505341 603 266 UTR3 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000505341 660 277 UTR3 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000505341 629 280 UTR3 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000505341 509 280 UTR5 Trans
TCONS_00109427 serine hydroxymethyltransferase 1 (soluble) novel protein coding ENST00000505341 606 275 UTR3 Trans
TCONS_00119961 ring finger protein 152 novel protein coding ENST00000505341 714 282 UTR5 Trans
TCONS_00132247 zinc finger protein 43 novel noncoding ENST00000505341 633 277 noncoding Trans
TCONS_00132247 zinc finger protein 43 novel noncoding ENST00000505341 632 277 noncoding Trans
TCONS_00135884 zinc finger protein 347 novel protein coding ENST00000505341 694 285 UTR5 Trans
TCONS_00140732 NCK adaptor protein 2 novel protein coding ENST00000505341 628 283 UTR5 Trans
TCONS_00141670 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000505341 616 279 UTR5 Trans
TCONS_00141673 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000505341 616 279 UTR5 Trans
TCONS_00141679 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000505341 616 279 UTR5 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding ENST00000505341 654 280 UTR3 Trans
TCONS_00148704 WD repeat containing planar cell polarity effector novel protein coding ENST00000505341 612 275 UTR3 Trans
TCONS_00148705 WD repeat containing planar cell polarity effector novel protein coding ENST00000505341 612 275 UTR3 Trans
TCONS_00150627 UDP-glucuronate decarboxylase 1 novel protein coding ENST00000505341 601 278 UTR5 Trans
TCONS_00157701 VAMP (vesicle-associated membrane protein)-associated protein B and C novel protein coding ENST00000505341 604 278 UTR5 Trans
TCONS_00165341 TTC28 antisense RNA 1 novel protein coding ENST00000505341 603 269 UTR5 Trans
TCONS_00171146 F-box and leucine-rich repeat protein 2 novel noncoding ENST00000505341 656 287 noncoding Trans
TCONS_00174508 calcium-sensing receptor novel protein coding ENST00000505341 626 278 UTR5 Trans
TCONS_00175246 interleukin 20 receptor beta novel protein coding ENST00000505341 624 277 UTR5 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000505341 642 279 UTR3 Trans
TCONS_00194682 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000505341 631 278 UTR3 Trans
TCONS_00210636 polymerase (DNA directed), eta novel noncoding ENST00000505341 639 287 noncoding Trans
TCONS_00211226 antisense novel protein coding ENST00000505341 616 282 UTR5 Trans
TCONS_00216783 KH homology domain containing 1 novel noncoding ENST00000505341 633 280 noncoding Trans
TCONS_00233718 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2 novel protein coding ENST00000505341 609 281 UTR5 Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000505341 648 278 UTR3 Trans
TCONS_00242866 glyoxylate reductase/hydroxypyruvate reductase novel protein coding ENST00000505341 605 279 UTR3 Trans
TCONS_00249683 suppressor of cancer cell invasion novel protein coding ENST00000505341 661 264 UTR3 Trans

Sequence

>TCONS_00249683 (1880 nt)
GCAGCGGGCTGAGGCACCTTCGGGCAACACCCAATACTCGGGGCTCCGCTCGGCTTCTTTGCGCCGAGATGCCTAAGAAGGCTGGTGCGACGACCAAGGC
CAGTAGCAGGTCCCGTGGCGGCAGAGGGGTGGGCCTCAGGGGTACTTGTTGAAGAGCGCGGGAGAAGCGGGGCCCGGGAGTGAGTGGAGGCACTGCCAGC
GGCTTGCCGTCTCTCAGTTCCGGGGCTCAGGACAGCCGCCGCCACCCCCAGAGCTGCGGCCTGCTGCCGTCGCCCCGCCTCAGTAGGCTGCGCTGCCGTC
CACCTGGTGATTTCTGAGCGCTGGGCCCGGCGGCAGCCGAGCTCTCCTTGGGCTGCGTGTGCTGACCTTTGGCCTCCTACCCGCACTCCCAGTCCAGCAA
TTCATGTTCCCGCAGCGGCATGACCTGCGTTTCCCCAGGAGGCTGTATTCTGCTTTCTCCTCCCTTGCTTTGGCTGATCGCACCCCTTCTGTCAAGAATA
CAGCACTCCCATTTCCACCATCTTTGTTTGGCCAACCCCAGTCCGTTTCTCAGACTCAGCTCAAGCACTGCCTCCTGCTGGCAGCATTCTCCAGTGCCCC
AATGCTGATTTGCCTGTGGGGTAATGTTCTGTGCCTATCTCATCGGTGCACTTAGCACAGTGTATTATAATTTTGTATGTTCTTTCTCCCTCGCAGCAGT
CCGAGCTCCTTGAGAGCAAGGACCATGTACCTTTTCATCTTTACATATCCATTGCCTACATATTTGTTGAACGAAAGTTCCTAGCACAGCCCCTGTCCCA
TAACAGGCCTTTAAATATCAAGCACTATTTTTTTTTCCTCCCTTTCCCGCAACATGCAGACATACACACTTTCACCAACATTTATTAGCTCCGACTGCAT
GAGATACAATGATGAATAATAAATGATCCCTGCCCCCAAGGAATTGGAAATACAAAGCAGAGGGAGGAGCAAGCATTAAGGTTTAGAAGCCAGAGTTAGG
TTTTCTTGCAAGGGGGGAAAAAACACTGTTGGGTTGATGGGAACCCTTCGTGGGAAAATTGAGTAGAGCCTTGAAGGTTGTGGGAAAAGCTTTCTAGGTG
GCCAGAAGTCCCTGGACACCACTGATGAGCCTAGTTTGTCTGTTAAGGGTGAAAGGGGGTAGTGGAAGAATCAAATTAAATGTGTGGGAAAATATTTTGT
AACCTGTAAAGTTGTGTGGTTGTCATTTTAGGGTAAAAGCCAGAGCAAGGAACCAGAGAGACCACTTCCTCCCTTAGGTCCTGTGGCAGTTGATCCTAAA
GGATGCGTCACCATAGCCATCCATGCAAAACCTGGCTCCAAACAAAATGCTGTAACAGATTTGACAGCAGAGGCTGTAAATGTAGCTATTGCAGCACCTC
CATCAGAGGGAGAGGCTAATGCTGAGCTCTGTCGGTATCTTTCCAAGGTCCTAGAACTCAGGAAGAGTGATGTGGTTTTGGATAAGGGTGGTAAATCTCG
TGAAAAGGTGGTGAAGCTTTTGGCTTCTACAACTCCAGAAGAGATCTTGGAGAAATTAAAAAAGGAAGCCAAAAAAACATAAAAGCAAGAAATGAGGCCG
GGCGCAGTGGCTCATGCCTGTAATCCCAGCACTTTGGGAGGCCGTGGTGGGCGGATCACCTGAGGTCAGGAGTTCGAGACCAGCCTGACCAACATGGTGA
AACCCCATCTCTACGAAAAATACAAAATTAGCCAGATGTGATGGCGCATGCCTGTAATCCCAGTTACTCAGGAGGCTGAGGCAGGAGAATCACTTGAACC
TGGGGGGCGGAGGTTGCAGTAAGCCGAGATCGCGCCGTTGCACTCCAGCCTGGGCAACAAGAGTGAAACTCTCTCCCCCCG

Expression



Full and truncated open reading frames discovered in TCONS_00249683

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.