Detailed information on ENST00000506875

lncRNA-RNA interactions

Number of interactions: 7

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000261486 erythrocyte membrane protein band 4.1 like 4A protein coding ENST00000506875 798 271 CDS Cis
ENST00000507810 erythrocyte membrane protein band 4.1 like 4A processed transcript ENST00000506875 798 271 noncoding Cis
ENST00000513333 erythrocyte membrane protein band 4.1 like 4A processed transcript ENST00000506875 798 271 noncoding Cis
ENST00000515047 erythrocyte membrane protein band 4.1 like 4A retained intron ENST00000506875 798 271 noncoding Cis
ENST00000621003 erythrocyte membrane protein band 4.1 like 4A protein coding ENST00000506875 798 271 CDS Cis
TCONS_00204910 erythrocyte membrane protein band 4.1 like 4A novel protein coding ENST00000506875 798 271 CDS Cis
TCONS_00204911 erythrocyte membrane protein band 4.1 like 4A novel noncoding ENST00000506875 798 271 noncoding Cis

Sequence

>TCONS_00204911 (493 nt)
GGGATGGAGGGGTTGGCAGCAGCACAGCATAGCAGAATTTTCTGATTCACTACCACTGCTGGTGTTACAGCGTGAACGTGACCTGAAGACAAAAAGGCTG
TACAGAATCATTGTCACTTCCACAGGAGGGGTTTCGGCGACGCGTGTAAGGGAACTTTGGCGACTTAGTGCGATCACTGGGAGAATTGTAGAGTCCACTG
GAGAGAAAGAAAAATGGTCAAAAAGAGCCCAGAGAGTTCCTGGGGGAAAACACACCGCAGCCCAGACCTATTCATAACTGCACAGCTGGTACTTCCAGAG
GCACATGCACCAGGGGCACGTGGTTCTCTTTGCTGACAAGATTTATTAAAAGAAAAGAGGAAAGAACTATTCTAAAATGGACCCTCCCTCCAAAAAAGCC
CAAACAGCCAAAGCAATTCTAAGCAGAAAGAACAAAGCTGGAGGCATCACACTACCTGACTTCAAACTGTACTACAAGGCTACAGTAACAAAAA

Expression



Full and truncated open reading frames discovered in TCONS_00204911

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.