Detailed information on ENST00000515210

lncRNA-RNA interactions

Number of interactions: 32

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000330676 TLC domain containing 2 protein coding ENST00000515210 619 299 UTR3 Trans
ENST00000439138 transmembrane protein 98 protein coding ENST00000515210 559 280 UTR5 Trans
ENST00000478730 ORAI calcium release-activated calcium modulator 2 protein coding ENST00000515210 601 278 UTR3 Trans
ENST00000482603 glyoxylate reductase/hydroxypyruvate reductase processed transcript ENST00000515210 567 279 noncoding Trans
TCONS_00009834 SRY (sex determining region Y)-box 13 novel protein coding ENST00000515210 621 293 UTR3 Trans
TCONS_00011236 solute carrier family 35, member F3 novel protein coding ENST00000515210 614 298 UTR3 Trans
TCONS_00020768 processed_transcript novel protein coding ENST00000515210 631 300 UTR5 Trans
TCONS_00030591 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000515210 618 312 UTR3 Trans
TCONS_00095053 epithelial membrane protein 2 novel protein coding ENST00000515210 539 277 UTR3 Trans
TCONS_00095053 epithelial membrane protein 2 novel protein coding ENST00000515210 612 296 UTR3 Trans
TCONS_00098643 fatty acid 2-hydroxylase novel protein coding ENST00000515210 612 287 UTR5 Trans
TCONS_00098644 fatty acid 2-hydroxylase novel protein coding ENST00000515210 600 284 UTR3 Trans
TCONS_00098644 fatty acid 2-hydroxylase novel protein coding ENST00000515210 612 287 UTR3 Trans
TCONS_00098645 fatty acid 2-hydroxylase novel protein coding ENST00000515210 600 284 UTR3 Trans
TCONS_00098645 fatty acid 2-hydroxylase novel protein coding ENST00000515210 612 287 UTR3 Trans
TCONS_00098647 fatty acid 2-hydroxylase novel protein coding ENST00000515210 600 284 UTR3 Trans
TCONS_00098647 fatty acid 2-hydroxylase novel protein coding ENST00000515210 612 287 UTR3 Trans
TCONS_00118582 centrosomal protein 76kDa novel protein coding ENST00000515210 604 278 UTR3 Trans
TCONS_00132233 zinc finger protein 43 novel protein coding ENST00000515210 628 296 UTR5 Trans
TCONS_00165341 TTC28 antisense RNA 1 novel protein coding ENST00000515210 618 292 UTR5 Trans
TCONS_00186316 KIAA0232 novel protein coding ENST00000515210 615 305 UTR3 Trans
TCONS_00192322 tec protein tyrosine kinase novel protein coding ENST00000515210 617 289 UTR5 Trans
TCONS_00192322 tec protein tyrosine kinase novel protein coding ENST00000515210 603 270 UTR5 Trans
TCONS_00192331 tec protein tyrosine kinase novel protein coding ENST00000515210 603 270 UTR3 Trans
TCONS_00213738 enoyl-CoA delta isomerase 2 novel protein coding ENST00000515210 642 301 UTR3 Trans
TCONS_00235205 epithelial splicing regulatory protein 1 novel protein coding ENST00000515210 647 299 UTR3 Trans
TCONS_00235219 epithelial splicing regulatory protein 1 novel protein coding ENST00000515210 647 299 UTR3 Trans
TCONS_00235231 epithelial splicing regulatory protein 1 novel protein coding ENST00000515210 647 299 UTR3 Trans
TCONS_00240685 metastasis suppressor 1 novel protein coding ENST00000515210 511 235 UTR3 Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000515210 629 280 UTR3 Trans
TCONS_00247058 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 novel protein coding ENST00000515210 612 296 UTR3 Trans
TCONS_00252827 discs, large homolog 3 (Drosophila) novel protein coding ENST00000515210 626 298 UTR5 Trans

Sequence

>TCONS_00252827 (590 nt)
ATTCTGTTCCTTAGAAGTGAGTCACTAAGACCATCCCACACTGAGTGGGGTATTAGGGCTTAGGCACCACTTTTTGAAAGGAGGAATGCTAAATAATTTT
CAGGCTTTTTTTTTTTTTGGCAGCAGAGTCTCGCTCTGTTGCCCAGGCTGGAGTGCAGTGGCTTGATCTCGGCTCTCTGCAACCTCTGCCTCCCGGGTTC
AAGCGATTCTCCTGCCTCAGCCTCCCGAGTATCTGGGATTACAGGCATGCACCACCACACTTGGCTAATTTTTTTGTATTTTTAGTAGAGACAGGGTTTC
ACCATGTTGGCCAGGCTAGTCTCAAACTCCTGACCTCAAGAGATTCACCTGCCTTGGCCTCCCAAAGTGCTGGAATTACAGGCATGAGCCACTGCACCCA
GCCTCAGGTTTATTTTTTCAATTACTATGGGATGTCAGAGAGGGAAAAACAAGCCATTAGGTGGTTGCAGTCAGCAGCAGGTGGATCGTGAAGACCTCAG
CATGCCATTGCAATCTGTAGAGATCATCCAGCCCCTCTTAGAACTTGACCAAAATAGAAGTAAATTAAAGTTGTACATTGGACACCTGACA

Expression



Full and truncated open reading frames discovered in TCONS_00252827

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.