Detailed information on ENST00000517637

lncRNA-RNA interactions

Number of interactions: 12

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000494969 colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) protein coding ENST00000517637 568 274 CDS Trans
ENST00000498535 makorin ring finger protein 1 nonsense mediated decay ENST00000517637 524 268 CDS Trans
ENST00000511184 E74-like factor 2 (ets domain transcription factor) nonsense mediated decay ENST00000517637 524 271 CDS_UTR Trans
ENST00000620139 melanoregulin protein coding ENST00000517637 513 266 UTR3 Trans
TCONS_00030130 calcium/calmodulin-dependent protein kinase II gamma novel protein coding ENST00000517637 601 262 UTR3 Trans
TCONS_00032151 long intergenic non-protein coding RNA 959 novel protein coding ENST00000517637 515 268 UTR5 Trans
TCONS_00080928 SH3-domain GRB2-like 3 novel protein coding ENST00000517637 615 277 UTR5 Trans
TCONS_00118919 potassium channel tetramerization domain containing 1 novel protein coding ENST00000517637 633 277 UTR3 Trans
TCONS_00119961 ring finger protein 152 novel protein coding ENST00000517637 633 279 UTR5 Trans
TCONS_00137691 FOS-like antigen 2 novel protein coding ENST00000517637 611 278 UTR5 Trans
TCONS_00221037 POU class 6 homeobox 2 novel noncoding ENST00000517637 612 267 noncoding Trans
TCONS_00230128 solute carrier family 26 (anion exchanger), member 5 novel protein coding ENST00000517637 609 278 UTR3 Trans

Sequence

>TCONS_00230128 (462 nt)
AACAAAACAAAGACGCTGGGGAAACTTCACCAAGAGCCTCGGCAGCTCCAGAGCGACGGGAAACGAAAGATTTTGCTGGAGGAGCTTGCCAACAGCGATC
CCAAGTTAGCCCTCACTGGAGTTCCTATAGTACAGTGGCCAAAAAGGGATAAGTGTGGAATGGAAAAGAGAAGAAAGGGGCCGGGCATGGTGGCTCACAC
CTGTAATCCCAGCACTTTGGGAGGCCCAGGCAGGTGGATCACCTGAGGTCAGGAGTTCAAGACCAGCCTGGCCAACATGGTGAAACACCGTCTGTACCAA
AAATACAAAAATTAAGCCAGGCGTGGTGGCATGCGCCTATAATCCCAGCTACTTGCAAGGCTGGGGCAGGAGAATCACTTGAACCCAGGAGGCAGAGGTT
GCAGTGAGCCGAGATCGCACCATTGCACTTCAGCCTGGGGGACAAGAGCGAAACTGTCTCAAA

Expression



Full and truncated open reading frames discovered in TCONS_00230128

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.