| Potential function | Interacting transcript | Gene description | Transcript biotype | lncRNA id | Alignment score (LAST) | Alignment length | Transcript region involved in interaction | Genomic orientation of interacting RNAs |
|---|---|---|---|---|---|---|---|---|
| ENST00000323699 | delta(4)-desaturase, sphingolipid 1 | protein coding | ENST00000519635 | 520 | 218 | UTR3 | Trans | |
| ENST00000391877 | delta(4)-desaturase, sphingolipid 1 | protein coding | ENST00000519635 | 520 | 218 | UTR3 | Trans | |
| ENST00000424496 | sense_intronic | sense intronic | ENST00000519635 | 514 | 262 | noncoding | Trans | |
| ENST00000482603 | glyoxylate reductase/hydroxypyruvate reductase | processed transcript | ENST00000519635 | 542 | 258 | noncoding | Trans | |
| TCONS_00028040 | ankyrin repeat domain 16 | novel protein coding | ENST00000519635 | 608 | 258 | UTR3 | Trans | |
| TCONS_00095053 | epithelial membrane protein 2 | novel protein coding | ENST00000519635 | 556 | 248 | UTR3 | Trans | |
| TCONS_00195633 | aspartylglucosaminidase | novel protein coding | ENST00000519635 | 506 | 258 | UTR3 | Trans | |
| TCONS_00202516 | family with sequence similarity 173, member B | novel protein coding | ENST00000519635 | 605 | 258 | UTR3 | Trans | |
| TCONS_00210637 | polymerase (DNA directed), eta | novel protein coding | ENST00000519635 | 508 | 260 | UTR3 | Trans | |
| TCONS_00251977 | G protein-coupled receptor 82 | novel protein coding | ENST00000519635 | 527 | 259 | UTR3 | Trans | |
| TCONS_00252827 | discs, large homolog 3 (Drosophila) | novel protein coding | ENST00000519635 | 600 | 257 | UTR5 | Trans |
>TCONS_00252827 (577 nt)
AAACTCCAGGCACCTAAGCAAGCCCCACGCAGCCGTCTGCATTTTTCAATCCCTCCAACCTCGCCTTTTGCTATTTCCCCCACCCCACCTACGGCACGTT
CCGGTCATAACCAACTAGCTCCTCGCTGAAACTGGCTCACACCGCGGAAGCCCGGGTCGGTGTCGGGGCGAGCCTTCCCTCCTTTTCCTGGAGCCCGTCT
CAGAGTCTTGCTGTGTCACCCAGGCTGCCAGGCTGGAGTGGAGTGGCATGATCTCGGCTGACTGCAACCTCTGCCTCCCAGGTTCAAGCAATTGCCCTGC
CTCAGCCTCCCGAATAGCTGGGATTACAGGCACATGCCACCACACCCGGCTGATATTTGTATTTTTAGTAGAGACGGGGTTTTACCGTCTTGGCCAGGCT
GGTCTTGAACTCCTGACTTCAGGTGATCCACCCACCTTGGCCTCCCAAAGTGTTGGGATTACAGGCCTGAGCCACCGTGCCCGGCAGTGCTTGGTCTTAT
TAAACGCTTTATGAAAGGCAGAACTGGGGCTCCCTTGCATCTTCCAGTTACAAATTCAGTGCCTTCTGCAGTTTCCCC
In silico ORF/peptide predictions
Nothing found.
RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.