Detailed information on ENST00000522261

lncRNA-RNA interactions

Number of interactions: 52

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000264893 septin 11 protein coding ENST00000522261 567 295 UTR3 Trans
ENST00000309060 zinc fingers and homeoboxes 3 protein coding ENST00000522261 586 298 UTR3 Trans
ENST00000338758 parvin, beta protein coding ENST00000522261 628 306 UTR3 Trans
ENST00000339732 polypeptide N-acetylgalactosaminyltransferase 15 protein coding ENST00000522261 626 301 UTR3 Trans
ENST00000356454 sosondowah ankyrin repeat domain family member C protein coding ENST00000522261 548 303 UTR3 Trans
ENST00000378004 Rho GTPase activating protein 26 protein coding ENST00000522261 516 303 UTR3 Trans
ENST00000382142 myotubularin related protein 12 protein coding ENST00000522261 584 288 UTR3 Trans
ENST00000421422 zinc fingers and homeoboxes 3 protein coding ENST00000522261 586 298 UTR3 Trans
ENST00000439138 transmembrane protein 98 protein coding ENST00000522261 520 291 UTR5 Trans
ENST00000482603 glyoxylate reductase/hydroxypyruvate reductase processed transcript ENST00000522261 599 289 noncoding Trans
ENST00000547865 spermatogenesis associated, serine-rich 2 protein coding ENST00000522261 509 311 UTR3 Trans
ENST00000607772 CNKSR family member 3 protein coding ENST00000522261 637 303 UTR3 Trans
ENST00000620139 melanoregulin protein coding ENST00000522261 580 302 UTR3 Trans
TCONS_00016418 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 novel protein coding ENST00000522261 519 292 UTR3 Trans
TCONS_00030588 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000522261 507 300 UTR3 Trans
TCONS_00030591 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000522261 626 303 UTR3 Trans
TCONS_00030591 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000522261 615 284 UTR3 Trans
TCONS_00030592 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000522261 626 303 UTR3 Trans
TCONS_00051891 RNA binding motif, single stranded interacting protein 2 novel protein coding ENST00000522261 625 304 UTR3 Trans
TCONS_00075844 forkhead box N3 novel protein coding ENST00000522261 545 291 UTR3 Trans
TCONS_00075845 forkhead box N3 novel protein coding ENST00000522261 545 291 UTR3 Trans
TCONS_00095053 epithelial membrane protein 2 novel protein coding ENST00000522261 577 274 UTR3 Trans
TCONS_00098643 fatty acid 2-hydroxylase novel protein coding ENST00000522261 630 294 UTR5 Trans
TCONS_00098644 fatty acid 2-hydroxylase novel protein coding ENST00000522261 630 294 UTR3 Trans
TCONS_00098645 fatty acid 2-hydroxylase novel protein coding ENST00000522261 630 294 UTR3 Trans
TCONS_00098647 fatty acid 2-hydroxylase novel protein coding ENST00000522261 630 294 UTR3 Trans
TCONS_00116668 desmoglein 3 novel protein coding ENST00000522261 647 302 UTR3 Trans
TCONS_00117136 CBP80/20-dependent translation initiation factor novel protein coding ENST00000522261 540 302 UTR3 Trans
TCONS_00147093 ATPase family, AAA domain containing 2B novel protein coding ENST00000522261 601 296 UTR3 Trans
TCONS_00149280 Uncharacterized protein {ECO:0000313|Ensembl:ENSP00000416453} novel protein coding ENST00000522261 554 302 UTR3 Trans
TCONS_00150696 septin 10 novel protein coding ENST00000522261 621 296 UTR3 Trans
TCONS_00159951 zinc fingers and homeoboxes 3 novel protein coding ENST00000522261 638 301 UTR3 Trans
TCONS_00159952 zinc fingers and homeoboxes 3 novel protein coding ENST00000522261 638 301 UTR3 Trans
TCONS_00165715 LIM domain kinase 2 novel protein coding ENST00000522261 519 288 UTR3 Trans
TCONS_00165721 LIM domain kinase 2 novel protein coding ENST00000522261 519 288 UTR3 Trans
TCONS_00184373 neutral cholesterol ester hydrolase 1 novel protein coding ENST00000522261 606 297 UTR3 Trans
TCONS_00191796 G protein-coupled receptor 125 novel protein coding ENST00000522261 629 302 UTR5 Trans
TCONS_00191797 G protein-coupled receptor 125 novel protein coding ENST00000522261 629 302 UTR3 Trans
TCONS_00192331 tec protein tyrosine kinase novel protein coding ENST00000522261 525 290 UTR3 Trans
TCONS_00194652 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000522261 673 288 UTR5 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000522261 673 288 UTR5 Trans
TCONS_00195633 aspartylglucosaminidase novel protein coding ENST00000522261 554 287 UTR3 Trans
TCONS_00203985 family with sequence similarity 169, member A novel protein coding ENST00000522261 604 302 UTR5 Trans
TCONS_00210637 polymerase (DNA directed), eta novel protein coding ENST00000522261 530 288 UTR3 Trans
TCONS_00226586 diacylglycerol kinase, beta 90kDa novel protein coding ENST00000522261 537 299 UTR3 Trans
TCONS_00226588 diacylglycerol kinase, beta 90kDa novel protein coding ENST00000522261 537 299 UTR3 Trans
TCONS_00232466 tumor suppressor candidate 3 novel protein coding ENST00000522261 522 281 UTR3 Trans
TCONS_00232467 tumor suppressor candidate 3 novel protein coding ENST00000522261 522 281 UTR3 Trans
TCONS_00234854 zinc finger and BTB domain containing 10 novel protein coding ENST00000522261 601 298 UTR3 Trans
TCONS_00243136 glioblastoma down-regulated RNA novel protein coding ENST00000522261 503 285 UTR3 Trans
TCONS_00247616 unprocessed_pseudogene novel protein coding ENST00000522261 503 285 UTR3 Trans
TCONS_00247617 unprocessed_pseudogene novel protein coding ENST00000522261 503 285 UTR3 Trans

Sequence

>TCONS_00247617 (588 nt)
TTTGTGAAACTTCACAATGTTCGGGAGGACATTGTGAATGATATTACAGCTGAACACATTTCTATTTGGCCATCTTCCATTCCCAAGTAAGTAGTGGTAT
AGCTTTTATTTTATTAATTGAGTTATGTATTTGGAAACCATTCTGACTAGTATAGATACCCTTAGATAATTTTATTAAAGGGCCAGAAATCTAAGATTCT
ACAGTCTTTGTGTTTCTCTATTATGATAATGATAATTATCTTCCTGTAAATTGTGGATAAGGCATAACCCTTTTTTTTTTTTTTTTTTTTGAGGCAGAGT
CTCACTCTGTTGCCCAGGCTGGAATGCAGTGGTACAATCTCTGCTCACTGCAATCTCTGCCTCTTGGGCTCAAGCAATTCTCATGCCTCAGCCTCCCAAA
TAGCTGGGATTACAGGCACCCACCACCACGCCTGGCTAATTTTTGTATTTTTAGTAGACACATGGTTTTGCCATGTTGGCCAGGCTGGTCTCAAACTCCT
GACCTCAAGTGATCTGCCCACCTCAGCCTCCCAAAGTGCTGGGATTACAGGCAGGAGCTACCACACCTGGCCCAGCATAACTCTTAAGT

Expression



Full and truncated open reading frames discovered in TCONS_00247617

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.