| Potential function | Interacting transcript | Gene description | Transcript biotype | lncRNA id | Alignment score (LAST) | Alignment length | Transcript region involved in interaction | Genomic orientation of interacting RNAs |
|---|---|---|---|---|---|---|---|---|
| ENST00000359543 | epithelial membrane protein 2 | protein coding | ENST00000546937 | 673 | 307 | UTR3 | Trans | |
| ENST00000397755 | zinc finger family member 788 | processed transcript | ENST00000546937 | 525 | 287 | noncoding | Trans | |
| ENST00000494969 | colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) | protein coding | ENST00000546937 | 545 | 301 | CDS | Trans | |
| ENST00000511184 | E74-like factor 2 (ets domain transcription factor) | nonsense mediated decay | ENST00000546937 | 523 | 264 | CDS_UTR | Trans | |
| TCONS_00095049 | epithelial membrane protein 2 | novel protein coding | ENST00000546937 | 673 | 307 | UTR3 | Trans | |
| TCONS_00095050 | epithelial membrane protein 2 | novel protein coding | ENST00000546937 | 673 | 307 | UTR3 | Trans | |
| TCONS_00095052 | epithelial membrane protein 2 | novel protein coding | ENST00000546937 | 673 | 307 | UTR3 | Trans | |
| TCONS_00118919 | potassium channel tetramerization domain containing 1 | novel protein coding | ENST00000546937 | 609 | 289 | UTR3 | Trans | |
| TCONS_00119961 | ring finger protein 152 | novel protein coding | ENST00000546937 | 676 | 291 | UTR5 | Trans | |
| TCONS_00132247 | zinc finger protein 43 | novel noncoding | ENST00000546937 | 606 | 289 | noncoding | Trans | |
| TCONS_00141670 | Rho guanine nucleotide exchange factor (GEF) 4 | novel protein coding | ENST00000546937 | 603 | 291 | UTR5 | Trans | |
| TCONS_00141673 | Rho guanine nucleotide exchange factor (GEF) 4 | novel protein coding | ENST00000546937 | 603 | 291 | UTR5 | Trans | |
| TCONS_00141679 | Rho guanine nucleotide exchange factor (GEF) 4 | novel protein coding | ENST00000546937 | 603 | 291 | UTR5 | Trans | |
| TCONS_00147100 | ATPase family, AAA domain containing 2B | novel protein coding | ENST00000546937 | 602 | 278 | UTR3 | Trans | |
| TCONS_00171146 | F-box and leucine-rich repeat protein 2 | novel noncoding | ENST00000546937 | 617 | 284 | noncoding | Trans | |
| TCONS_00194682 | E74-like factor 2 (ets domain transcription factor) | novel protein coding | ENST00000546937 | 622 | 281 | UTR3 | Trans | |
| TCONS_00198052 | NSA2 ribosome biogenesis homolog (S. cerevisiae) | novel protein coding | ENST00000546937 | 500 | 281 | UTR3 | Trans | |
| TCONS_00224726 | caldesmon 1 | novel protein coding | ENST00000546937 | 535 | 291 | UTR3 | Trans | |
| TCONS_00224728 | caldesmon 1 | novel protein coding | ENST00000546937 | 535 | 291 | UTR3 | Trans | |
| TCONS_00240688 | metastasis suppressor 1 | novel protein coding | ENST00000546937 | 625 | 306 | UTR3 | Trans |
>TCONS_00240688 (983 nt)
CGGCCTGGGCGAAAGAGTGAGACTCCGTCTCAAAAAAATAAATAAATAAATAAAATAAAATAAATGAAAACCACACTAGGCCAGGCACAGTGGCTCACGT
CTGTAATCCCAGCACTTTGGGATGCCGAGGCAGGCAGATCACCTGAGGTCTGGAGTTTGAGACCAGCCCGACCAACACAGAGAAACCCCATCTCTACTAA
AAATACAAAAGTTAGCTGGGTGTGGTGGTGCATGCCTGTAGTCCCAGCTACTCAGGAGGCTGAGGCAGGAGAATCACTTGAACCCAGGAGGCAGAGGTTG
CAATAAGCCGAGATGGCGCCAATGCACTCCAGCCTGGGCAACAAGAGCAAAACCCCATCTCAAAAAACAAACAAACAAACAAAACTAATTAAAATCAATT
AGGGAAAGCTTTTTAGAATAGGTTGTTGGAGCTAGATTTGGAAAGAAAAGTAAGGATATAAATTACTAATGTACAGAGGTAGAAGAGAGTGACCCAAGGC
TGAGGACATTTCTAGGTGCCTTATGCCCGCTCAGAGGCCCACCTCACAGAGCTGCTGGAGGAGATATGTGACCGGATGAAGGAGTATGGGGAACAGATTG
ATCCTTCCACCCATCGCAAGAACTACGTACGTGTAGTGGGCCGGAATGGAGAATCCAGTGAACTGGACCTACAAGGCATCCGAATCGACTCAGATATTAG
CGGCACCCTCAAGTTTGCGTGTGAGAGCATTGTGGAGGAATACGAGGATGAACTCATTGAATTCTTTTCCCGAGAGGCTGACAATGTTAAAGACAAACTT
TGCAGTAAGCGAACAGATCTTTGTGACCATGCCCTGCACATATCGCATGATGAGCTATGAACCACTGGAGCAGCCCACACTGGCTTGATGGATCACCCCC
AGGAGGGGAAAATGGTGGCAATGCCTTTTATATATTATGTTTTTACTGAAATTAACTGAAAAAATATGAAACCAAAAGTACAAA
In silico ORF/peptide predictions
Nothing found.
RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.