Detailed information on ENST00000547430

lncRNA-RNA interactions

Number of interactions: 156

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000227155 CD82 molecule protein coding ENST00000547430 621 308 UTR3 Trans
ENST00000242057 aryl hydrocarbon receptor protein coding ENST00000547430 614 294 UTR3 Trans
ENST00000257189 desmoglein 3 protein coding ENST00000547430 578 311 UTR3 Trans
ENST00000306390 leucine-rich alpha-2-glycoprotein 1 protein coding ENST00000547430 518 298 UTR3 Trans
ENST00000309060 zinc fingers and homeoboxes 3 protein coding ENST00000547430 650 304 UTR3 Trans
ENST00000323816 growth arrest-specific 7 protein coding ENST00000547430 601 289 UTR3 Trans
ENST00000339732 polypeptide N-acetylgalactosaminyltransferase 15 protein coding ENST00000547430 626 304 UTR3 Trans
ENST00000353047 cathepsin B protein coding ENST00000547430 637 302 UTR3 Trans
ENST00000367590 xenotropic and polytropic retrovirus receptor 1 protein coding ENST00000547430 601 250 UTR3 Trans
ENST00000373857 platelet-activating factor receptor protein coding ENST00000547430 648 300 UTR3 Trans
ENST00000380641 centlein, centrosomal protein protein coding ENST00000547430 662 303 UTR3 Trans
ENST00000399322 diacylglycerol kinase, beta 90kDa protein coding ENST00000547430 600 297 UTR3 Trans
ENST00000410023 interleukin 1 receptor, type I protein coding ENST00000547430 567 293 UTR3 Trans
ENST00000421422 zinc fingers and homeoboxes 3 protein coding ENST00000547430 650 304 UTR3 Trans
ENST00000437099 growth arrest-specific 7 protein coding ENST00000547430 601 289 UTR3 Trans
ENST00000448214 antisense antisense ENST00000547430 678 296 noncoding Trans
ENST00000463496 aryl hydrocarbon receptor nonsense mediated decay ENST00000547430 614 294 UTR3 Trans
ENST00000539896 platelet-activating factor receptor protein coding ENST00000547430 648 300 UTR3 Trans
ENST00000543196 polypeptide N-acetylgalactosaminyltransferase 6 protein coding ENST00000547430 542 304 UTR3 Trans
ENST00000560870 sense_intronic sense intronic ENST00000547430 547 260 noncoding Trans
ENST00000620788 pleckstrin homology-like domain, family B, member 1 retained intron ENST00000547430 658 302 noncoding Trans
ENST00000621141 G protein-coupled receptor 1 protein coding ENST00000547430 511 258 UTR3 Trans
TCONS_00001821 low density lipoprotein receptor adaptor protein 1 novel protein coding ENST00000547430 685 297 UTR3 Trans
TCONS_00001823 low density lipoprotein receptor adaptor protein 1 novel protein coding ENST00000547430 685 297 UTR3 Trans
TCONS_00009095 xenotropic and polytropic retrovirus receptor 1 novel protein coding ENST00000547430 601 250 UTR3 Trans
TCONS_00009834 SRY (sex determining region Y)-box 13 novel protein coding ENST00000547430 636 297 UTR3 Trans
TCONS_00013935 platelet-activating factor receptor novel protein coding ENST00000547430 648 300 UTR3 Trans
TCONS_00023682 pre-mRNA processing factor 18 novel protein coding ENST00000547430 602 298 UTR3 Trans
TCONS_00023685 pre-mRNA processing factor 18 novel protein coding ENST00000547430 602 298 UTR3 Trans
TCONS_00023687 pre-mRNA processing factor 18 novel protein coding ENST00000547430 602 298 UTR3 Trans
TCONS_00023689 pre-mRNA processing factor 18 novel protein coding ENST00000547430 602 298 UTR3 Trans
TCONS_00025760 zinc finger, MIZ-type containing 1 novel protein coding ENST00000547430 632 303 UTR5 Trans
TCONS_00025761 zinc finger, MIZ-type containing 1 novel protein coding ENST00000547430 632 303 UTR5 Trans
TCONS_00025775 zinc finger, MIZ-type containing 1 novel protein coding ENST00000547430 632 303 UTR5 Trans
TCONS_00030165 antisense novel protein coding ENST00000547430 678 296 UTR5 Trans
TCONS_00030588 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000547430 630 304 UTR3 Trans
TCONS_00030591 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000547430 641 307 UTR3 Trans
TCONS_00030591 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000547430 647 298 UTR3 Trans
TCONS_00030591 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000547430 589 297 UTR3 Trans
TCONS_00030592 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000547430 641 307 UTR3 Trans
TCONS_00034642 CD82 molecule novel protein coding ENST00000547430 621 308 UTR3 Trans
TCONS_00034643 CD82 molecule novel protein coding ENST00000547430 621 308 UTR3 Trans
TCONS_00039782 GRAM domain containing 1B novel protein coding ENST00000547430 635 304 UTR5 Trans
TCONS_00050195 FYVE, RhoGEF and PH domain containing 4 novel protein coding ENST00000547430 640 294 UTR5 Trans
TCONS_00050741 spermatogenesis associated, serine-rich 2 novel protein coding ENST00000547430 548 234 UTR3 Trans
TCONS_00050741 spermatogenesis associated, serine-rich 2 novel protein coding ENST00000547430 616 299 UTR3 Trans
TCONS_00050741 spermatogenesis associated, serine-rich 2 novel protein coding ENST00000547430 642 303 UTR3 Trans
TCONS_00051891 RNA binding motif, single stranded interacting protein 2 novel protein coding ENST00000547430 608 307 UTR3 Trans
TCONS_00053851 transmembrane protein 263 novel protein coding ENST00000547430 604 299 UTR5 Trans
TCONS_00075917 ribosomal protein S6 kinase, 90kDa, polypeptide 5 novel noncoding ENST00000547430 645 297 noncoding Trans
TCONS_00090929 nucleoporin 93kDa novel protein coding ENST00000547430 640 302 UTR3 Trans
TCONS_00090941 nucleoporin 93kDa novel protein coding ENST00000547430 640 302 UTR5 Trans
TCONS_00095053 epithelial membrane protein 2 novel protein coding ENST00000547430 576 262 UTR3 Trans
TCONS_00098643 fatty acid 2-hydroxylase novel protein coding ENST00000547430 644 295 UTR5 Trans
TCONS_00098643 fatty acid 2-hydroxylase novel protein coding ENST00000547430 606 304 UTR5 Trans
TCONS_00098644 fatty acid 2-hydroxylase novel protein coding ENST00000547430 606 304 UTR3 Trans
TCONS_00098644 fatty acid 2-hydroxylase novel protein coding ENST00000547430 644 295 UTR3 Trans
TCONS_00098645 fatty acid 2-hydroxylase novel protein coding ENST00000547430 644 295 UTR3 Trans
TCONS_00098647 fatty acid 2-hydroxylase novel protein coding ENST00000547430 644 295 UTR3 Trans
TCONS_00101169 myosin phosphatase Rho interacting protein novel protein coding ENST00000547430 635 304 UTR3 Trans
TCONS_00101169 myosin phosphatase Rho interacting protein novel protein coding ENST00000547430 639 306 UTR3 Trans
TCONS_00103261 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000547430 604 300 UTR5 Trans
TCONS_00103262 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000547430 604 300 UTR5 Trans
TCONS_00108999 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000547430 633 290 UTR5 Trans
TCONS_00109000 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000547430 633 290 UTR5 Trans
TCONS_00109009 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000547430 633 290 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000547430 633 290 UTR5 Trans
TCONS_00109012 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000547430 633 290 UTR5 Trans
TCONS_00109013 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000547430 633 290 UTR5 Trans
TCONS_00109014 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000547430 633 290 UTR5 Trans
TCONS_00116668 desmoglein 3 novel protein coding ENST00000547430 578 311 UTR3 Trans
TCONS_00116669 desmoglein 3 novel protein coding ENST00000547430 578 311 UTR3 Trans
TCONS_00117136 CBP80/20-dependent translation initiation factor novel protein coding ENST00000547430 559 302 UTR3 Trans
TCONS_00119049 GRB2 associated, regulator of MAPK1 novel protein coding ENST00000547430 536 312 UTR3 Trans
TCONS_00119512 zinc finger and BTB domain containing 7C novel protein coding ENST00000547430 544 302 UTR3 Trans
TCONS_00124891 zinc finger protein 540 novel protein coding ENST00000547430 632 305 UTR5 Trans
TCONS_00124891 zinc finger protein 540 novel protein coding ENST00000547430 634 262 UTR5 Trans
TCONS_00125901 zinc finger protein 226 novel protein coding ENST00000547430 554 306 UTR3 Trans
TCONS_00125904 zinc finger protein 226 novel protein coding ENST00000547430 554 306 UTR3 Trans
TCONS_00133831 carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) novel protein coding ENST00000547430 623 307 UTR3 Trans
TCONS_00140732 NCK adaptor protein 2 novel protein coding ENST00000547430 608 304 UTR3 Trans
TCONS_00141667 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000547430 691 302 UTR3 Trans
TCONS_00141667 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000547430 617 298 UTR3 Trans
TCONS_00141670 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000547430 615 306 UTR5 Trans
TCONS_00141670 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000547430 691 302 UTR3 Trans
TCONS_00141673 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000547430 615 306 UTR5 Trans
TCONS_00141673 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000547430 691 302 UTR3 Trans
TCONS_00141679 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000547430 691 302 UTR3 Trans
TCONS_00141679 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000547430 615 306 UTR5 Trans
TCONS_00141679 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000547430 617 298 UTR3 Trans
TCONS_00141681 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000547430 691 302 UTR3 Trans
TCONS_00142157 LY6/PLAUR domain containing 6B novel noncoding ENST00000547430 610 302 noncoding Trans
TCONS_00142157 LY6/PLAUR domain containing 6B novel noncoding ENST00000547430 602 305 noncoding Trans
TCONS_00142157 LY6/PLAUR domain containing 6B novel noncoding ENST00000547430 661 288 noncoding Trans
TCONS_00142168 LY6/PLAUR domain containing 6B novel protein coding ENST00000547430 661 288 UTR3 Trans
TCONS_00142168 LY6/PLAUR domain containing 6B novel protein coding ENST00000547430 602 305 UTR3 Trans
TCONS_00142168 LY6/PLAUR domain containing 6B novel protein coding ENST00000547430 610 302 UTR3 Trans
TCONS_00142174 LY6/PLAUR domain containing 6B novel protein coding ENST00000547430 602 305 UTR3 Trans
TCONS_00142174 LY6/PLAUR domain containing 6B novel protein coding ENST00000547430 610 302 UTR3 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding ENST00000547430 642 295 UTR3 Trans
TCONS_00148704 WD repeat containing planar cell polarity effector novel protein coding ENST00000547430 601 304 UTR3 Trans
TCONS_00148705 WD repeat containing planar cell polarity effector novel protein coding ENST00000547430 601 304 UTR3 Trans
TCONS_00149280 Uncharacterized protein {ECO:0000313|Ensembl:ENSP00000416453} novel protein coding ENST00000547430 631 303 UTR3 Trans
TCONS_00149280 Uncharacterized protein {ECO:0000313|Ensembl:ENSP00000416453} novel protein coding ENST00000547430 552 303 UTR3 Trans
TCONS_00159951 zinc fingers and homeoboxes 3 novel protein coding ENST00000547430 614 299 UTR3 Trans
TCONS_00159952 zinc fingers and homeoboxes 3 novel protein coding ENST00000547430 614 299 UTR3 Trans
TCONS_00160920 protein tyrosine kinase 6 novel protein coding ENST00000547430 632 306 UTR5 Trans
TCONS_00163095 T-cell lymphoma invasion and metastasis 1 novel protein coding ENST00000547430 531 301 UTR3 Trans
TCONS_00184373 neutral cholesterol ester hydrolase 1 novel protein coding ENST00000547430 717 303 UTR3 Trans
TCONS_00186316 KIAA0232 novel protein coding ENST00000547430 645 301 UTR5 Trans
TCONS_00186316 KIAA0232 novel protein coding ENST00000547430 641 305 UTR3 Trans
TCONS_00190799 sorting nexin 25 novel protein coding ENST00000547430 629 293 UTR3 Trans
TCONS_00190999 zinc finger protein 721 novel protein coding ENST00000547430 602 303 UTR5 Trans
TCONS_00192322 tec protein tyrosine kinase novel protein coding ENST00000547430 617 295 UTR5 Trans
TCONS_00192331 tec protein tyrosine kinase novel protein coding ENST00000547430 611 294 UTR3 Trans
TCONS_00194652 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000547430 636 299 UTR5 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000547430 636 299 UTR5 Trans
TCONS_00195633 aspartylglucosaminidase novel protein coding ENST00000547430 543 260 UTR3 Trans
TCONS_00196475 F-box and leucine-rich repeat protein 7 novel protein coding ENST00000547430 679 307 UTR3 Trans
TCONS_00199320 sorting nexin 24 novel noncoding ENST00000547430 607 290 noncoding Trans
TCONS_00200504 Rho GTPase activating protein 26 novel protein coding ENST00000547430 640 304 UTR3 Trans
TCONS_00202516 family with sequence similarity 173, member B novel protein coding ENST00000547430 619 301 UTR3 Trans
TCONS_00210637 polymerase (DNA directed), eta novel protein coding ENST00000547430 540 274 UTR3 Trans
TCONS_00210928 leucine rich repeat containing 1 novel protein coding ENST00000547430 695 303 UTR3 Trans
TCONS_00211226 antisense novel protein coding ENST00000547430 622 297 UTR3 Trans
TCONS_00213181 tubby like protein 4 novel protein coding ENST00000547430 646 298 UTR3 Trans
TCONS_00213182 tubby like protein 4 novel protein coding ENST00000547430 605 304 UTR3 Trans
TCONS_00213191 tubby like protein 4 novel protein coding ENST00000547430 646 298 UTR3 Trans
TCONS_00220258 aryl hydrocarbon receptor novel protein coding ENST00000547430 614 294 UTR3 Trans
TCONS_00222403 protein tyrosine phosphatase, non-receptor type 12 novel protein coding ENST00000547430 618 297 UTR5 Trans
TCONS_00224728 caldesmon 1 novel protein coding ENST00000547430 614 291 UTR3 Trans
TCONS_00230811 kielin/chordin-like protein novel protein coding ENST00000547430 689 303 UTR3 Trans
TCONS_00235281 NADH dehydrogenase (ubiquinone) complex I, assembly factor 6 novel protein coding ENST00000547430 666 304 UTR5 Trans
TCONS_00235281 NADH dehydrogenase (ubiquinone) complex I, assembly factor 6 novel protein coding ENST00000547430 625 295 UTR5 Trans
TCONS_00235292 NADH dehydrogenase (ubiquinone) complex I, assembly factor 6 novel protein coding ENST00000547430 603 307 UTR3 Trans
TCONS_00235393 processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae) novel protein coding ENST00000547430 694 294 UTR5 Trans
TCONS_00235708 oxidation resistance 1 novel protein coding ENST00000547430 625 301 UTR3 Trans
TCONS_00237101 cathepsin B novel protein coding ENST00000547430 637 302 UTR3 Trans
TCONS_00237103 cathepsin B novel protein coding ENST00000547430 637 302 UTR3 Trans
TCONS_00239255 tumor protein D52 novel protein coding ENST00000547430 656 299 UTR5 Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000547430 635 305 UTR3 Trans
TCONS_00243475 osteoclast stimulating factor 1 novel protein coding ENST00000547430 644 284 UTR3 Trans
TCONS_00243477 osteoclast stimulating factor 1 novel protein coding ENST00000547430 697 301 UTR5 Trans
TCONS_00243482 osteoclast stimulating factor 1 novel protein coding ENST00000547430 697 301 UTR5 Trans
TCONS_00243482 osteoclast stimulating factor 1 novel protein coding ENST00000547430 644 284 UTR5 Trans
TCONS_00243489 proprotein convertase subtilisin/kexin type 5 novel protein coding ENST00000547430 617 305 UTR3 Trans
TCONS_00247058 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 novel protein coding ENST00000547430 605 303 UTR3 Trans
TCONS_00247297 family with sequence similarity 166, member B novel protein coding ENST00000547430 679 302 UTR5 Trans
TCONS_00247562 contactin associated protein-like 3 novel protein coding ENST00000547430 602 302 UTR3 Trans
TCONS_00247576 contactin associated protein-like 3 novel protein coding ENST00000547430 671 307 UTR3 Trans
TCONS_00247594 contactin associated protein-like 3 novel protein coding ENST00000547430 671 307 UTR3 Trans
TCONS_00251977 G protein-coupled receptor 82 novel protein coding ENST00000547430 574 301 UTR3 Trans
TCONS_00252827 discs, large homolog 3 (Drosophila) novel protein coding ENST00000547430 628 303 UTR5 Trans
TCONS_00252827 discs, large homolog 3 (Drosophila) novel protein coding ENST00000547430 719 304 UTR5 Trans
TCONS_00253055 uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae) novel protein coding ENST00000547430 669 293 UTR3 Trans
TCONS_00253752 queuine tRNA-ribosyltransferase 1 pseudogene 1 novel protein coding ENST00000547430 562 274 UTR3 Trans

Sequence

>TCONS_00253752 (710 nt)
AATTTTTTTTTTTTTTTTTTTTTTTGACATGGAGTCTCACTCTGTCGCCAGGCTGGAGTGCAGTGGCATGATCTTGGCTCACTGCAACCTCTGCCTCCCA
GGTTCAAGTGATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGATTACAGGCGTTTGCCACCATGCCTAGCTAATTTTTGTATTTTTAGTAGAGACGAGGT
TTCACCATGTTGGCCAGGATGGTCTCGATCTCTTGACCTCATTATCCCTCCACCTTGGCTTCCCAAAGTGCTGGGATTACAGGCGTGAGCCACTGAGCCC
GGCCTAGTTAAATAAAATTTGATAAACACGATGGACTTGGTTGTGTGTTTTCTGGTTTTTCTGAGATCTAGTTTGAAAATTCTGACAACTAGCAAAGTAT
ATGGAAGCTTCTTCAGGAAATAGTAAACATATTTCTTTTTACAGCCTAATAGTCCCAGTGAATATTGTTTTTATGTGGATAGTGATATGGTCAATGAATT
CAAGTTGGAATTGGTAGAAAAACTTTTTGCTGAAGACACAGAAGCAAAGAACCCATTTTCTACTCAGGACACAGATTTAGACTTGGAGATGTTAGCTCCC
TATATCCCAATGGATGATGACTTCCAGTTACGTTCCTTCGATCAGTTGTCACCATTAGAAAGCAGTTCCGCAAGCCCTGAAAGCGCAAGTCCTCAAAGCA
CAGTTACAGTA

Expression



Full and truncated open reading frames discovered in TCONS_00253752

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.