| Potential function | Interacting transcript | Gene description | Transcript biotype | lncRNA id | Alignment score (LAST) | Alignment length | Transcript region involved in interaction | Genomic orientation of interacting RNAs |
|---|---|---|---|---|---|---|---|---|
| ENST00000263026 | eukaryotic elongation factor-2 kinase | protein coding | ENST00000549743 | 619 | 284 | UTR3 | Trans | |
| ENST00000397755 | zinc finger family member 788 | processed transcript | ENST00000549743 | 597 | 283 | noncoding | Trans | |
| ENST00000527227 | NAD synthetase 1 | retained intron | ENST00000549743 | 514 | 258 | noncoding | Trans | |
| ENST00000530055 | NAD synthetase 1 | protein coding | ENST00000549743 | 514 | 258 | UTR5 | Trans | |
| ENST00000583694 | FYVE, RhoGEF and PH domain containing 4 | protein coding | ENST00000549743 | 531 | 260 | UTR5 | Trans | |
| TCONS_00028040 | ankyrin repeat domain 16 | novel protein coding | ENST00000549743 | 606 | 267 | UTR3 | Trans | |
| TCONS_00030130 | calcium/calmodulin-dependent protein kinase II gamma | novel protein coding | ENST00000549743 | 642 | 278 | UTR3 | Trans | |
| TCONS_00032153 | long intergenic non-protein coding RNA 959 | novel noncoding | ENST00000549743 | 611 | 275 | noncoding | Trans | |
| TCONS_00037379 | NAD synthetase 1 | novel protein coding | ENST00000549743 | 514 | 258 | UTR5 | Trans | |
| TCONS_00037380 | NAD synthetase 1 | novel protein coding | ENST00000549743 | 514 | 258 | UTR5 | Trans | |
| TCONS_00065093 | UBA domain containing 2 | novel protein coding | ENST00000549743 | 604 | 277 | UTR5 | Trans | |
| TCONS_00065094 | UBA domain containing 2 | novel protein coding | ENST00000549743 | 604 | 277 | UTR5 | Trans | |
| TCONS_00065103 | UBA domain containing 2 | novel protein coding | ENST00000549743 | 604 | 277 | UTR5 | Trans | |
| TCONS_00070307 | pecanex homolog (Drosophila) | novel protein coding | ENST00000549743 | 617 | 282 | UTR5 | Trans | |
| TCONS_00089062 | eukaryotic elongation factor-2 kinase | novel protein coding | ENST00000549743 | 619 | 284 | UTR3 | Trans | |
| TCONS_00089065 | eukaryotic elongation factor-2 kinase | novel protein coding | ENST00000549743 | 619 | 284 | UTR3 | Trans | |
| TCONS_00089066 | eukaryotic elongation factor-2 kinase | novel protein coding | ENST00000549743 | 619 | 284 | UTR3 | Trans | |
| TCONS_00107851 | transient receptor potential cation channel, subfamily V, member 1 | novel protein coding | ENST00000549743 | 645 | 265 | UTR5 | Trans | |
| TCONS_00107864 | transient receptor potential cation channel, subfamily V, member 1 | novel protein coding | ENST00000549743 | 645 | 265 | UTR3 | Trans | |
| TCONS_00118919 | potassium channel tetramerization domain containing 1 | novel protein coding | ENST00000549743 | 662 | 286 | UTR3 | Trans | |
| TCONS_00119512 | zinc finger and BTB domain containing 7C | novel protein coding | ENST00000549743 | 606 | 281 | UTR3 | Trans | |
| TCONS_00119961 | ring finger protein 152 | novel protein coding | ENST00000549743 | 621 | 284 | UTR5 | Trans | |
| TCONS_00135884 | zinc finger protein 347 | novel protein coding | ENST00000549743 | 598 | 282 | UTR5 | Trans | |
| TCONS_00137691 | FOS-like antigen 2 | novel protein coding | ENST00000549743 | 651 | 283 | UTR5 | Trans | |
| TCONS_00141404 | GLI family zinc finger 2 | novel protein coding | ENST00000549743 | 612 | 272 | UTR5 | Trans | |
| TCONS_00147093 | ATPase family, AAA domain containing 2B | novel protein coding | ENST00000549743 | 603 | 278 | UTR3 | Trans | |
| TCONS_00147100 | ATPase family, AAA domain containing 2B | novel protein coding | ENST00000549743 | 627 | 282 | UTR3 | Trans | |
| TCONS_00147113 | ATPase family, AAA domain containing 2B | novel protein coding | ENST00000549743 | 603 | 278 | UTR5 | Trans | |
| TCONS_00150627 | UDP-glucuronate decarboxylase 1 | novel protein coding | ENST00000549743 | 646 | 299 | UTR5 | Trans | |
| TCONS_00185321 | transferrin receptor | novel protein coding | ENST00000549743 | 624 | 278 | UTR5 | Trans | |
| TCONS_00197324 | zinc finger, SWIM-type containing 6 | novel protein coding | ENST00000549743 | 615 | 254 | UTR3 | Trans | |
| TCONS_00199319 | sorting nexin 24 | novel noncoding | ENST00000549743 | 500 | 279 | noncoding | Trans | |
| TCONS_00200901 | GM2 ganglioside activator | novel protein coding | ENST00000549743 | 600 | 283 | UTR3 | Trans | |
| TCONS_00200902 | GM2 ganglioside activator | novel protein coding | ENST00000549743 | 600 | 283 | UTR3 | Trans | |
| TCONS_00219475 | WD repeat domain 27 | novel protein coding | ENST00000549743 | 617 | 282 | UTR3 | Trans | |
| TCONS_00230128 | solute carrier family 26 (anion exchanger), member 5 | novel protein coding | ENST00000549743 | 711 | 283 | UTR3 | Trans | |
| TCONS_00235393 | processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae) | novel protein coding | ENST00000549743 | 600 | 284 | UTR5 | Trans |
>TCONS_00235393 (614 nt)
GGGCATATGCTAAGTGGGCAGCATGGAGGGCAGGCAGGCTTGGTACCCCAGCAGAGCTCACAGCCAGTGCTATCACAGAAGCCCATGGGCACCATGCCAC
CTTCCATGTGCATGAAGCCGCAGCAATTGGCAATGCAGCAGCAGCTGGCAAACAGCTTCTTCCCAGATACAGAAGAGGAAACAGAAGTGGAGGTTAAGTA
ACTTGTCCAAGATTACACAGCAGCTAGCAGAGCTAGATCTGAAGTCTGGTCGGTACTCCTCTTAACTGTTTACTGCCTCAGGATTCCAGGAGAGGGAGTT
TGGGTTAGTCCTTAAGAAAGTGGGAGCTCTGGCCAGGTGCTGTGGCTCACGCCTTTAATCCCAGCACTTTGGGAGGCTGAGGCGGGTGGATCACCTGAGG
TCAGGAGTTCCAGACCAGCCTGGCCAACATGGTGAAACCTCGTTTCTACTAAAAATACAAAAATTAGCTGGGCTTGGTGGTGGGCACCTGTAATCACAGC
TACTCGGCAGGCTGAGGCAGGAGAATCGCTTGAACCCAGGAAGCAGAGGTTGCAGTGAGCCTAAATTGCACCATTGCACTCCAGCCTGGGTGACAAGAGC
AAGACTCTGTCTTTA
In silico ORF/peptide predictions
Nothing found.
RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.