Detailed information on ENST00000556072

lncRNA-RNA interactions

Number of interactions: 83

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000262134 lysophosphatidylcholine acyltransferase 2 protein coding ENST00000556072 514 306 UTR3 Trans
ENST00000280800 phospholipase B domain containing 2 protein coding ENST00000556072 640 313 UTR3 Trans
ENST00000336505 suppressor of cancer cell invasion protein coding ENST00000556072 650 295 UTR3 Trans
ENST00000353231 C-type lectin domain family 7, member A protein coding ENST00000556072 593 305 UTR3 Trans
ENST00000359543 epithelial membrane protein 2 protein coding ENST00000556072 678 319 UTR3 Trans
ENST00000382044 tumor protein p53 binding protein 1 protein coding ENST00000556072 646 308 UTR3 Trans
ENST00000524264 SAP30L antisense RNA 1 (head to head) antisense ENST00000556072 705 313 noncoding Trans
ENST00000527227 NAD synthetase 1 retained intron ENST00000556072 501 258 noncoding Trans
ENST00000529743 lincRNA lincRNA ENST00000556072 670 292 noncoding Trans
ENST00000530055 NAD synthetase 1 protein coding ENST00000556072 501 258 UTR5 Trans
ENST00000532572 protease, serine, 23 retained intron ENST00000556072 635 296 noncoding Trans
ENST00000548404 transcribed_unprocessed_pseudogene processed transcript ENST00000556072 550 280 noncoding Trans
ENST00000556539 signal transducer and activator of transcription 2, 113kDa processed transcript ENST00000556072 685 300 noncoding Trans
ENST00000572705 transient receptor potential cation channel, subfamily V, member 1 protein coding ENST00000556072 663 300 UTR3 Trans
ENST00000579685 adenomatosis polyposis coli down-regulated 1 nonsense mediated decay ENST00000556072 548 302 CDS Trans
ENST00000587344 sense_intronic sense intronic ENST00000556072 637 304 noncoding Trans
ENST00000590442 zinc finger protein 532 retained intron ENST00000556072 638 298 noncoding Trans
ENST00000607772 CNKSR family member 3 protein coding ENST00000556072 670 298 UTR3 Trans
TCONS_00017972 transcribed_unprocessed_pseudogene novel protein coding ENST00000556072 549 306 UTR3 Trans
TCONS_00025761 zinc finger, MIZ-type containing 1 novel protein coding ENST00000556072 531 298 UTR3 Trans
TCONS_00025775 zinc finger, MIZ-type containing 1 novel protein coding ENST00000556072 531 298 UTR3 Trans
TCONS_00037379 NAD synthetase 1 novel protein coding ENST00000556072 501 258 UTR5 Trans
TCONS_00037380 NAD synthetase 1 novel protein coding ENST00000556072 501 258 UTR5 Trans
TCONS_00046540 sestrin 3 novel protein coding ENST00000556072 627 307 UTR5 Trans
TCONS_00050192 FYVE, RhoGEF and PH domain containing 4 novel protein coding ENST00000556072 639 308 UTR5 Trans
TCONS_00050209 FYVE, RhoGEF and PH domain containing 4 novel protein coding ENST00000556072 639 308 UTR5 Trans
TCONS_00059486 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000556072 685 300 UTR3 Trans
TCONS_00059487 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000556072 685 300 UTR3 Trans
TCONS_00059488 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000556072 685 300 UTR3 Trans
TCONS_00059489 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000556072 685 300 UTR3 Trans
TCONS_00059491 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000556072 685 300 UTR3 Trans
TCONS_00059493 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000556072 685 300 UTR3 Trans
TCONS_00059495 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000556072 685 300 UTR3 Trans
TCONS_00059497 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000556072 685 300 UTR3 Trans
TCONS_00061180 golgin A2 pseudogene 5 novel protein coding ENST00000556072 550 280 UTR5 Trans
TCONS_00065093 UBA domain containing 2 novel protein coding ENST00000556072 662 291 UTR5 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding ENST00000556072 662 291 UTR5 Trans
TCONS_00065858 ubiquitin specific peptidase 12 novel protein coding ENST00000556072 508 295 UTR3 Trans
TCONS_00070307 pecanex homolog (Drosophila) novel protein coding ENST00000556072 624 295 UTR5 Trans
TCONS_00090805 lysophosphatidylcholine acyltransferase 2 novel protein coding ENST00000556072 514 306 UTR3 Trans
TCONS_00095049 epithelial membrane protein 2 novel protein coding ENST00000556072 678 319 UTR3 Trans
TCONS_00095050 epithelial membrane protein 2 novel protein coding ENST00000556072 678 319 UTR3 Trans
TCONS_00095052 epithelial membrane protein 2 novel protein coding ENST00000556072 678 319 UTR3 Trans
TCONS_00103261 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000556072 634 317 UTR5 Trans
TCONS_00103262 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000556072 634 317 UTR5 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000556072 663 300 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000556072 676 320 UTR5 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000556072 676 320 UTR3 Trans
TCONS_00108999 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000556072 634 300 UTR5 Trans
TCONS_00109000 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000556072 634 300 UTR5 Trans
TCONS_00109009 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000556072 634 300 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000556072 634 300 UTR5 Trans
TCONS_00109012 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000556072 634 300 UTR5 Trans
TCONS_00109013 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000556072 634 300 UTR5 Trans
TCONS_00109014 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000556072 634 300 UTR5 Trans
TCONS_00118919 potassium channel tetramerization domain containing 1 novel protein coding ENST00000556072 631 315 UTR3 Trans
TCONS_00119961 ring finger protein 152 novel protein coding ENST00000556072 718 300 UTR5 Trans
TCONS_00132247 zinc finger protein 43 novel noncoding ENST00000556072 695 309 noncoding Trans
TCONS_00135884 zinc finger protein 347 novel protein coding ENST00000556072 726 316 UTR5 Trans
TCONS_00140732 NCK adaptor protein 2 novel protein coding ENST00000556072 662 295 UTR5 Trans
TCONS_00142538 antisense novel protein coding ENST00000556072 659 316 UTR3 Trans
TCONS_00143295 nucleoporin 35kDa novel protein coding ENST00000556072 667 309 UTR3 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding ENST00000556072 629 281 UTR3 Trans
TCONS_00148704 WD repeat containing planar cell polarity effector novel protein coding ENST00000556072 661 313 UTR3 Trans
TCONS_00148705 WD repeat containing planar cell polarity effector novel protein coding ENST00000556072 661 313 UTR3 Trans
TCONS_00157701 VAMP (vesicle-associated membrane protein)-associated protein B and C novel protein coding ENST00000556072 606 312 UTR5 Trans
TCONS_00163367 runt-related transcription factor 1 novel protein coding ENST00000556072 644 309 UTR3 Trans
TCONS_00165341 TTC28 antisense RNA 1 novel protein coding ENST00000556072 613 293 UTR5 Trans
TCONS_00165713 LIM domain kinase 2 novel protein coding ENST00000556072 640 293 UTR3 Trans
TCONS_00175246 interleukin 20 receptor beta novel protein coding ENST00000556072 664 300 UTR5 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000556072 628 268 UTR3 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000556072 649 303 UTR3 Trans
TCONS_00194682 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000556072 643 319 UTR3 Trans
TCONS_00195828 LRP2 binding protein novel protein coding ENST00000556072 608 287 UTR5 Trans
TCONS_00215909 O-acyl-ADP-ribose deacylase 1 novel protein coding ENST00000556072 678 301 UTR3 Trans
TCONS_00230128 solute carrier family 26 (anion exchanger), member 5 novel protein coding ENST00000556072 618 295 UTR3 Trans
TCONS_00235205 epithelial splicing regulatory protein 1 novel protein coding ENST00000556072 663 311 UTR3 Trans
TCONS_00235219 epithelial splicing regulatory protein 1 novel protein coding ENST00000556072 663 311 UTR3 Trans
TCONS_00235231 epithelial splicing regulatory protein 1 novel protein coding ENST00000556072 663 311 UTR3 Trans
TCONS_00235685 oxidation resistance 1 novel protein coding ENST00000556072 632 320 UTR3 Trans
TCONS_00249683 suppressor of cancer cell invasion novel protein coding ENST00000556072 650 295 UTR3 Trans
TCONS_00251973 G protein-coupled receptor 34 novel protein coding ENST00000556072 585 288 UTR3 Trans
TCONS_00253055 uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae) novel protein coding ENST00000556072 647 308 UTR3 Trans

Sequence

>TCONS_00253055 (1683 nt)
GTCTCTTCCTTCCTAGGCCTACCTCTGTTGGTGCTTTTGTCTTCCAACCTCCCTATGTAGTAAGACCAGCCAAGCCCACATGCCCACTGGGAGCCCTGAA
ACCAGATCTGGTTTTCTGTCTTACCTGAACAGGTTCCCAGAACCCACACCAGGCCTCTGAATCAGTCTCTGAGAATCTGATTGATTTAAAGCCACTTGGT
TGCTTCCATTGCACTACCTGGGTTGCGATCCCCTCAATTGATTTAGTAAAAAGAAAACTTAGCGGCCGGGTGCGGTGGCTCACACCTGTAATCCCAGCAC
TTTGGGAGGCTGAGGCGGGTGGATCACCTGAGGTCGAGAGTTCCAGACCAGCCTGACCAACATGAAGAAATCCCGTCTCTACTAAAAATACAAAATTAGC
CGGGCGTGATGGCGCATGCCTGTAATCCCAGCTACTTGGAGGCTGAGGCAGGAGAATTGCTTGAACCTGGGAAGCGGAGGTTGTGGTGAGCCGAGATCAT
GCCATTGCACTCCAGCCTGGACAACAAGAGTGAAACTCCATCTCAAAAAAAAAAAAAGAAAAGAAAAGAAAAGAAAGAAAACTCAGCTAGGAATTAGAAA
CATCATTTGTCCTCTTGGCCTGTTCAGCTGGTGACTGTAGATTTGATGAAAAGGAAACTTGGGACTCCGGAGGACCAAGATGGAGCGAGACGGTCAATAC
TGATGGACTTGCAGCTAGCACCATGGCAGCCCTGCCTGGTCTAAGGAAGCTGGCAGGAGGCGATGGTACCTGGCGGGGGCAGACTGCCCACCTCCCCACT
CCTTCAGAGGACTGTTTCCTGCCCTTCACACCATCATCATGTTGGGCCCTGCATGTATGTTCCTGCACTTGGAGCGAGCCCAGGGACACAGGGCAGACAC
TGGGCTCACAGATGTTGCTGCAGCTGAGCCAGAAAACATTCCAGGCAGGAAAAGCAGGTGCACACATTCACACAGGCCTCTGGTCACTCGACCAGCCAGA
ATGAGACGGACTCCTTGACCTGGGAAGTCAAGTCCCAGTGGGAAGGGCTGGAAATCACACGTGGTCAACTTCTTGGCTCTCTCTGCTCCCCAAACCCTGG
CCCTAGGCTTGCTTTATCATCACATCCCAAGGCCAGAGGGCTGCTGCTGTCCCCATCTTGGCCCTGCTAGAAGAGGGATAGGGGTGGCTGGCATGATGGG
TGAGGGGAACATGAGAATATGCAGAGGCCTTGGAGGAAGAGGACTGGCAGTTATGACAGGAAGGCTCTCTATACCTGGCTCCCCAGTGTTCTGCCCCTGG
CACTGAGCATGAGGAGCCAGGCTTTGGGGAGACTTTGCAATCACCCCCCCAACCTGGTCCATTTTCCACAGGTAGCTTTCTTGAACTCACCTTGACCCCT
CCTCAGCCAGCAGCCCCCACCTCCAGGGGCAAAGGAGCTGAAAGACAGTCCTGAACTGGGGGGAGCTGGGATCACATCAGCCAGGCCCTGTCCCTCACAG
GAAGTGAGATGAGGTGATACCATGGATGGTGACTAAGGCCCCAAAGTCCCTGCCTCTCTGCCTCCCCAGAAACCTCACAGCCAGGCCAGCCCCCAGAGCA
GAGCCTGTGTAAACATGCCCAGGAGGGGAGGAGGGGTTGCTACATATGAGAAACAGTTAAAAATAAATTTAAAAAGCACCACTA

Expression



Full and truncated open reading frames discovered in TCONS_00253055

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.