Detailed information on ENST00000556167

lncRNA-RNA interactions

Number of interactions: 44

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000359543 epithelial membrane protein 2 protein coding ENST00000556167 647 297 UTR3 Trans
ENST00000494969 colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) protein coding ENST00000556167 580 292 CDS Trans
ENST00000524264 SAP30L antisense RNA 1 (head to head) antisense ENST00000556167 654 289 noncoding Trans
ENST00000549365 DNA-damage regulated autophagy modulator 1 nonsense mediated decay ENST00000556167 510 249 UTR3 Trans
ENST00000556539 signal transducer and activator of transcription 2, 113kDa processed transcript ENST00000556167 663 289 noncoding Trans
ENST00000572705 transient receptor potential cation channel, subfamily V, member 1 protein coding ENST00000556167 642 297 UTR3 Trans
ENST00000590442 zinc finger protein 532 retained intron ENST00000556167 630 296 noncoding Trans
ENST00000607772 CNKSR family member 3 protein coding ENST00000556167 650 291 UTR3 Trans
TCONS_00013935 platelet-activating factor receptor novel protein coding ENST00000556167 601 297 UTR3 Trans
TCONS_00039782 GRAM domain containing 1B novel protein coding ENST00000556167 611 288 UTR5 Trans
TCONS_00059486 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000556167 663 289 UTR3 Trans
TCONS_00059487 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000556167 663 289 UTR3 Trans
TCONS_00059488 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000556167 663 289 UTR3 Trans
TCONS_00059489 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000556167 663 289 UTR3 Trans
TCONS_00059491 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000556167 663 289 UTR3 Trans
TCONS_00059493 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000556167 663 289 UTR3 Trans
TCONS_00059495 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000556167 663 289 UTR3 Trans
TCONS_00059497 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000556167 663 289 UTR3 Trans
TCONS_00065093 UBA domain containing 2 novel protein coding ENST00000556167 636 291 UTR5 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding ENST00000556167 636 291 UTR5 Trans
TCONS_00080928 SH3-domain GRB2-like 3 novel protein coding ENST00000556167 625 292 UTR5 Trans
TCONS_00095049 epithelial membrane protein 2 novel protein coding ENST00000556167 647 297 UTR3 Trans
TCONS_00095050 epithelial membrane protein 2 novel protein coding ENST00000556167 647 297 UTR3 Trans
TCONS_00095052 epithelial membrane protein 2 novel protein coding ENST00000556167 647 297 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000556167 642 297 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000556167 644 279 UTR5 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000556167 644 279 UTR3 Trans
TCONS_00108999 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000556167 602 293 UTR5 Trans
TCONS_00109000 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000556167 602 293 UTR5 Trans
TCONS_00109009 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000556167 602 293 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000556167 602 293 UTR5 Trans
TCONS_00109012 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000556167 602 293 UTR5 Trans
TCONS_00109013 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000556167 602 293 UTR5 Trans
TCONS_00109014 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000556167 602 293 UTR5 Trans
TCONS_00119961 ring finger protein 152 novel protein coding ENST00000556167 663 298 UTR5 Trans
TCONS_00132247 zinc finger protein 43 novel noncoding ENST00000556167 638 291 noncoding Trans
TCONS_00132247 zinc finger protein 43 novel noncoding ENST00000556167 613 295 noncoding Trans
TCONS_00135884 zinc finger protein 347 novel protein coding ENST00000556167 644 291 UTR5 Trans
TCONS_00142538 antisense novel protein coding ENST00000556167 600 286 UTR3 Trans
TCONS_00143295 nucleoporin 35kDa novel protein coding ENST00000556167 608 297 UTR3 Trans
TCONS_00171146 F-box and leucine-rich repeat protein 2 novel noncoding ENST00000556167 602 288 noncoding Trans
TCONS_00175246 interleukin 20 receptor beta novel protein coding ENST00000556167 672 302 UTR5 Trans
TCONS_00216783 KH homology domain containing 1 novel noncoding ENST00000556167 600 286 noncoding Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000556167 652 298 UTR3 Trans

Sequence

>TCONS_00240688 (600 nt)
GCAACTTCCGGGAGGTGCTTGTGTGCCTGGTGCGGGAGCTACGGGGCCCAGGGATTGTGTTTAAAGTAGTGCTTCTACCAACATGTCCCGTGGTTCCAGC
GCCGGTTTTGACCGCCACATTACCATTTTTTCACCCGAGGGTCGGCTCTACCAAGTAGAATATGCTTTTAAGGCTATTAACCAGGGTGGCCTTACATCAG
TAGCTGTCAGAGGGAAAGACTGTGCAGTAATTGTCACACAGAAGAAAGTACCTGTAAGTAATACTGCCCAAATAGTTAATAATTGCAGAATATAAGAATT
TTTCAGCCAAGTGCAGTGGCTCACACCTGTAATCCCAGCACTTTGGGAGGCTGAGGTGGGCAGATCACCTTAGATCGGGAGTTCTAGACCAGCGTGACCA
ACATGGAGAAACCCTGTCTCTATTAAAAATACAAAATTAGTCAGGCGTGGTGGCACATGCCTGTAATTCCAGCTACTCGGGAGGCTGAGGCAGGAGAATC
ACTTGAACCTGGGAGGTGGAGGTTACGGTGAGCCAGGATCACACCATTGCACTCCAGCCTGGGCAACAACAGTGCAACTCCGTCTCAAAAAAAAAAAGAA
A

Expression



Full and truncated open reading frames discovered in TCONS_00240688

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.