| Potential function | Interacting transcript | Gene description | Transcript biotype | lncRNA id | Alignment score (LAST) | Alignment length | Transcript region involved in interaction | Genomic orientation of interacting RNAs |
|---|---|---|---|---|---|---|---|---|
| ENST00000309060 | zinc fingers and homeoboxes 3 | protein coding | ENST00000556205 | 619 | 299 | UTR3 | Trans | |
| ENST00000330676 | TLC domain containing 2 | protein coding | ENST00000556205 | 606 | 296 | UTR3 | Trans | |
| ENST00000345714 | serum/glucocorticoid regulated kinase family, member 3 | protein coding | ENST00000556205 | 613 | 306 | UTR3 | Trans | |
| ENST00000421422 | zinc fingers and homeoboxes 3 | protein coding | ENST00000556205 | 619 | 299 | UTR3 | Trans | |
| ENST00000478730 | ORAI calcium release-activated calcium modulator 2 | protein coding | ENST00000556205 | 611 | 293 | UTR3 | Trans | |
| ENST00000593250 | centrosomal protein 76kDa | nonsense mediated decay | ENST00000556205 | 613 | 278 | UTR3 | Trans | |
| TCONS_00030591 | cytoplasmic polyadenylation element binding protein 3 | novel protein coding | ENST00000556205 | 676 | 365 | UTR3 | Trans | |
| TCONS_00043422 | vacuolar protein sorting 37 homolog C (S. cerevisiae) | novel protein coding | ENST00000556205 | 663 | 366 | UTR5 | Trans | |
| TCONS_00050192 | FYVE, RhoGEF and PH domain containing 4 | novel protein coding | ENST00000556205 | 605 | 301 | UTR5 | Trans | |
| TCONS_00050209 | FYVE, RhoGEF and PH domain containing 4 | novel protein coding | ENST00000556205 | 605 | 301 | UTR5 | Trans | |
| TCONS_00065094 | UBA domain containing 2 | novel protein coding | ENST00000556205 | 604 | 265 | UTR5 | Trans | |
| TCONS_00065097 | UBA domain containing 2 | novel protein coding | ENST00000556205 | 604 | 265 | UTR3 | Trans | |
| TCONS_00065103 | UBA domain containing 2 | novel protein coding | ENST00000556205 | 604 | 265 | UTR5 | Trans | |
| TCONS_00065859 | ubiquitin specific peptidase 12 | novel protein coding | ENST00000556205 | 647 | 310 | UTR3 | Trans | |
| TCONS_00065864 | long intergenic non-protein coding RNA 412 | novel protein coding | ENST00000556205 | 604 | 297 | UTR3 | Trans | |
| TCONS_00090929 | nucleoporin 93kDa | novel protein coding | ENST00000556205 | 554 | 363 | UTR3 | Trans | |
| TCONS_00090939 | nucleoporin 93kDa | novel protein coding | ENST00000556205 | 554 | 363 | UTR3 | Trans | |
| TCONS_00090941 | nucleoporin 93kDa | novel protein coding | ENST00000556205 | 554 | 363 | UTR3 | Trans | |
| TCONS_00099311 | solute carrier family 7 (amino acid transporter light chain, L system), member 5 | novel protein coding | ENST00000556205 | 607 | 292 | UTR5 | Trans | |
| TCONS_00099312 | solute carrier family 7 (amino acid transporter light chain, L system), member 5 | novel protein coding | ENST00000556205 | 607 | 292 | UTR5 | Trans | |
| TCONS_00116668 | desmoglein 3 | novel protein coding | ENST00000556205 | 612 | 295 | UTR3 | Trans | |
| TCONS_00137691 | FOS-like antigen 2 | novel protein coding | ENST00000556205 | 613 | 313 | UTR5 | Trans | |
| TCONS_00148450 | coiled-coil domain containing 88A | novel protein coding | ENST00000556205 | 615 | 259 | UTR3 | Trans | |
| TCONS_00190999 | zinc finger protein 721 | novel protein coding | ENST00000556205 | 613 | 276 | UTR5 | Trans | |
| TCONS_00213738 | enoyl-CoA delta isomerase 2 | novel protein coding | ENST00000556205 | 528 | 297 | UTR3 | Trans | |
| TCONS_00213738 | enoyl-CoA delta isomerase 2 | novel protein coding | ENST00000556205 | 611 | 296 | UTR3 | Trans | |
| TCONS_00243503 | proprotein convertase subtilisin/kexin type 5 | novel protein coding | ENST00000556205 | 533 | 303 | UTR3 | Trans | |
| TCONS_00243507 | proprotein convertase subtilisin/kexin type 5 | novel protein coding | ENST00000556205 | 533 | 303 | UTR3 | Trans |
>TCONS_00243507 (598 nt)
AGGCGTGCACTGGTGAAGCCTCACCAGCTCAGGTCAGGGTGTCCACAGGTGCCTGTGGAGTAGGGGCACAGATGGGGAAGAAGAGGACTGGCAGGAAGTC
GTCGCAGGCTGTTCTCACAGGCCCTGTGCCACCTGTGGTCACGTAACTTGACTCTGGAAATGAGTGTTCTTTTTTTTTTTTGGAGACAGAGTCTTGCTCC
GTTGCCTAGGTTGGAGTGCAGTGGTGCGATCTTGGCTTACTGCAACGTCCGCCTCCCGGGTTCAAGTGATTCTCCTGCCTCAGCCTCCTGAGCAGCTGGG
ATTACAGGCATGTGCCACCACTCCCGGCTAATTTTGTATTTTTAGCAGAAATGGGATTTCACCATGTTGGCTAGGCTGGTCTCGAACTTCTGACCTCAGA
TGATCCACCTGCCTCAGCCTCCCAAGTGCTGGGATTACAGGCATGAGCCACCGCACCCGGCTTTTTTTTTTTTTTTCTTTTCTAATTTGAGACAGAGTCT
TGCTCTGTCGCCCAGGCTGGAGTTCAGTGGTGGTTTCTGAAGAATGATCAAACCATATAATTAAACCAATCATTTTAGGTAACTGTGTGATCCTCTAAC
In silico ORF/peptide predictions
Nothing found.
RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.