Detailed information on ENST00000563945

lncRNA-RNA interactions

Number of interactions: 42

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000263955 serine/threonine kinase 17b protein coding ENST00000563945 594 255 UTR3 Trans
ENST00000280800 phospholipase B domain containing 2 protein coding ENST00000563945 602 264 UTR3 Trans
ENST00000336505 suppressor of cancer cell invasion protein coding ENST00000563945 653 292 UTR3 Trans
ENST00000450928 antisense antisense ENST00000563945 518 262 noncoding Trans
ENST00000511184 E74-like factor 2 (ets domain transcription factor) nonsense mediated decay ENST00000563945 535 263 CDS_UTR Trans
ENST00000524264 SAP30L antisense RNA 1 (head to head) antisense ENST00000563945 617 270 noncoding Trans
ENST00000548404 transcribed_unprocessed_pseudogene processed transcript ENST00000563945 572 277 noncoding Trans
ENST00000556539 signal transducer and activator of transcription 2, 113kDa processed transcript ENST00000563945 639 291 noncoding Trans
ENST00000590442 zinc finger protein 532 retained intron ENST00000563945 617 276 noncoding Trans
TCONS_00013935 platelet-activating factor receptor novel protein coding ENST00000563945 625 274 UTR3 Trans
TCONS_00034643 CD82 molecule novel protein coding ENST00000563945 618 264 UTR3 Trans
TCONS_00059486 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000563945 639 291 UTR3 Trans
TCONS_00059487 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000563945 639 291 UTR3 Trans
TCONS_00059488 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000563945 639 291 UTR3 Trans
TCONS_00059489 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000563945 639 291 UTR3 Trans
TCONS_00059491 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000563945 639 291 UTR3 Trans
TCONS_00059493 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000563945 639 291 UTR3 Trans
TCONS_00059495 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000563945 639 291 UTR3 Trans
TCONS_00059497 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000563945 639 291 UTR3 Trans
TCONS_00061180 golgin A2 pseudogene 5 novel protein coding ENST00000563945 572 277 UTR5 Trans
TCONS_00065093 UBA domain containing 2 novel protein coding ENST00000563945 612 268 UTR5 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding ENST00000563945 612 268 UTR5 Trans
TCONS_00067572 DCN1, defective in cullin neddylation 1, domain containing 2 novel protein coding ENST00000563945 633 259 UTR3 Trans
TCONS_00080928 SH3-domain GRB2-like 3 novel protein coding ENST00000563945 609 295 UTR5 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000563945 631 276 UTR5 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000563945 694 276 UTR5 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000563945 694 276 UTR3 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000563945 631 276 UTR3 Trans
TCONS_00119961 ring finger protein 152 novel protein coding ENST00000563945 650 294 UTR5 Trans
TCONS_00132247 zinc finger protein 43 novel noncoding ENST00000563945 668 293 noncoding Trans
TCONS_00132247 zinc finger protein 43 novel noncoding ENST00000563945 638 292 noncoding Trans
TCONS_00135884 zinc finger protein 347 novel protein coding ENST00000563945 674 267 UTR5 Trans
TCONS_00140732 NCK adaptor protein 2 novel protein coding ENST00000563945 628 276 UTR5 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding ENST00000563945 649 276 UTR3 Trans
TCONS_00153158 serine/threonine kinase 17b novel protein coding ENST00000563945 594 255 UTR3 Trans
TCONS_00163367 runt-related transcription factor 1 novel protein coding ENST00000563945 603 294 UTR3 Trans
TCONS_00171146 F-box and leucine-rich repeat protein 2 novel noncoding ENST00000563945 637 270 noncoding Trans
TCONS_00175246 interleukin 20 receptor beta novel protein coding ENST00000563945 642 293 UTR5 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000563945 619 264 UTR3 Trans
TCONS_00233179 BCL2/adenovirus E1B 19kDa interacting protein 3-like novel protein coding ENST00000563945 608 261 UTR3 Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000563945 603 265 CDS_UTR Trans
TCONS_00249683 suppressor of cancer cell invasion novel protein coding ENST00000563945 653 292 UTR3 Trans

Sequence

>TCONS_00249683 (490 nt)
CGTCCGCGCGCCGGCGAGGCGAGGCGGCCGGGCCCTGCGCGTCAGGCCTGAGACCTGGGAGGAAGCTGGAGAAAAGATGCCCTCTGAATCTTTCTGTTTG
GCTGCCCAGGCTCGCCTCGACTCCAAATGGTTGAAAACAGATATACAGGTATTGAGTGTTGGTAGATATGAGAGTCCAGTGTTTAGAGCTGTGTTGCGTG
GCCGGGCGCAGTGGCTCACGCCTGTAATCCCGGCAGTTTGGGAGGCCGAGGCGGGTGGATGCCCTGAGGTCAGGAGTTGGAGACCAGCCTGACCAACATG
GTGAAACCCCGTCTCTACTAAAAATACAAAATTAGCCAGGCGTGGTGGTGTATGCCTGTAATCCCAGCCACTCGGGAGGCTGAGGCAGGAGAATCGCTTG
AACCCGGGAGGTGGAGGTTGCAATGGGTCAAGATCATGCCATTGCACTCCAGCCTGGACAATGAGAGCAAAACTGTTTCAAAAAAAAAAAA

Expression



Full and truncated open reading frames discovered in TCONS_00249683

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.