Detailed information on ENST00000568262

lncRNA-RNA interactions

Number of interactions: 80

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000263955 serine/threonine kinase 17b protein coding ENST00000568262 650 298 UTR3 Trans
ENST00000276431 tumor necrosis factor receptor superfamily, member 10b protein coding ENST00000568262 529 291 UTR3 Trans
ENST00000280800 phospholipase B domain containing 2 protein coding ENST00000568262 648 316 UTR3 Trans
ENST00000301178 AXL receptor tyrosine kinase protein coding ENST00000568262 617 316 UTR3 Trans
ENST00000336505 suppressor of cancer cell invasion protein coding ENST00000568262 642 297 UTR3 Trans
ENST00000368324 synaptotagmin XI protein coding ENST00000568262 627 299 UTR3 Trans
ENST00000375120 OTU deubiquitinase 3 protein coding ENST00000568262 613 303 UTR3 Trans
ENST00000377411 G protein-coupled receptor 157 protein coding ENST00000568262 607 302 UTR3 Trans
ENST00000450928 antisense antisense ENST00000568262 572 298 noncoding Trans
ENST00000511184 E74-like factor 2 (ets domain transcription factor) nonsense mediated decay ENST00000568262 589 300 CDS_UTR Trans
ENST00000521027 pleckstrin and Sec7 domain containing 3 protein coding ENST00000568262 512 302 CDS_UTR Trans
ENST00000524264 SAP30L antisense RNA 1 (head to head) antisense ENST00000568262 550 265 noncoding Trans
ENST00000536180 vacuole membrane protein 1 protein coding ENST00000568262 507 243 CDS Trans
ENST00000556539 signal transducer and activator of transcription 2, 113kDa processed transcript ENST00000568262 637 303 noncoding Trans
ENST00000620139 melanoregulin protein coding ENST00000568262 557 302 UTR3 Trans
TCONS_00008112 nicastrin novel protein coding ENST00000568262 543 318 UTR3 Trans
TCONS_00011236 solute carrier family 35, member F3 novel protein coding ENST00000568262 601 277 UTR3 Trans
TCONS_00012674 G protein-coupled receptor 157 novel protein coding ENST00000568262 607 302 UTR3 Trans
TCONS_00023291 adenosine deaminase, RNA-specific, B2 (non-functional) novel protein coding ENST00000568262 536 260 UTR3 Trans
TCONS_00023292 adenosine deaminase, RNA-specific, B2 (non-functional) novel protein coding ENST00000568262 536 260 UTR3 Trans
TCONS_00023296 adenosine deaminase, RNA-specific, B2 (non-functional) novel protein coding ENST00000568262 536 260 UTR3 Trans
TCONS_00023298 adenosine deaminase, RNA-specific, B2 (non-functional) novel protein coding ENST00000568262 536 260 UTR3 Trans
TCONS_00027001 programmed cell death 4 (neoplastic transformation inhibitor) novel protein coding ENST00000568262 669 291 UTR3 Trans
TCONS_00027009 programmed cell death 4 (neoplastic transformation inhibitor) novel protein coding ENST00000568262 669 291 UTR3 Trans
TCONS_00030130 calcium/calmodulin-dependent protein kinase II gamma novel protein coding ENST00000568262 693 289 UTR3 Trans
TCONS_00030588 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000568262 611 322 UTR3 Trans
TCONS_00032151 long intergenic non-protein coding RNA 959 novel protein coding ENST00000568262 572 272 UTR5 Trans
TCONS_00034642 CD82 molecule novel protein coding ENST00000568262 600 265 UTR3 Trans
TCONS_00034643 CD82 molecule novel protein coding ENST00000568262 600 265 UTR3 Trans
TCONS_00041296 RIC3 acetylcholine receptor chaperone novel protein coding ENST00000568262 614 309 UTR3 Trans
TCONS_00041298 RIC3 acetylcholine receptor chaperone novel protein coding ENST00000568262 614 309 UTR3 Trans
TCONS_00059486 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000568262 637 303 UTR3 Trans
TCONS_00059487 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000568262 637 303 UTR3 Trans
TCONS_00059488 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000568262 637 303 UTR3 Trans
TCONS_00059489 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000568262 637 303 UTR3 Trans
TCONS_00059491 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000568262 637 303 UTR3 Trans
TCONS_00059493 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000568262 637 303 UTR3 Trans
TCONS_00059495 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000568262 637 303 UTR3 Trans
TCONS_00059497 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000568262 637 303 UTR3 Trans
TCONS_00065093 UBA domain containing 2 novel protein coding ENST00000568262 610 321 UTR5 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding ENST00000568262 610 321 UTR5 Trans
TCONS_00070307 pecanex homolog (Drosophila) novel protein coding ENST00000568262 600 298 UTR5 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000568262 627 284 UTR5 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000568262 627 284 UTR3 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000568262 564 290 UTR5 Trans
TCONS_00114623 glutamine rich 2 novel protein coding ENST00000568262 602 299 UTR5 Trans
TCONS_00114628 phosphoribosyl pyrophosphate synthetase-associated protein 1 novel protein coding ENST00000568262 602 299 UTR3 Trans
TCONS_00118919 potassium channel tetramerization domain containing 1 novel protein coding ENST00000568262 611 267 UTR3 Trans
TCONS_00119478 zinc finger and BTB domain containing 7C novel protein coding ENST00000568262 633 305 UTR5 Trans
TCONS_00119512 zinc finger and BTB domain containing 7C novel protein coding ENST00000568262 539 284 UTR3 Trans
TCONS_00119961 ring finger protein 152 novel protein coding ENST00000568262 634 300 UTR5 Trans
TCONS_00125532 AXL receptor tyrosine kinase novel protein coding ENST00000568262 617 316 UTR3 Trans
TCONS_00140000 long intergenic non-protein coding RNA 152 novel protein coding ENST00000568262 604 298 UTR3 Trans
TCONS_00147093 ATPase family, AAA domain containing 2B novel protein coding ENST00000568262 632 277 UTR3 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding ENST00000568262 614 275 UTR3 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding ENST00000568262 632 277 UTR3 Trans
TCONS_00147106 ATPase family, AAA domain containing 2B novel protein coding ENST00000568262 632 277 UTR3 Trans
TCONS_00153158 serine/threonine kinase 17b novel protein coding ENST00000568262 650 298 UTR3 Trans
TCONS_00157701 VAMP (vesicle-associated membrane protein)-associated protein B and C novel protein coding ENST00000568262 616 279 UTR5 Trans
TCONS_00161482 BTB and CNC homology 1, basic leucine zipper transcription factor 1 novel protein coding ENST00000568262 613 306 UTR3 Trans
TCONS_00161482 BTB and CNC homology 1, basic leucine zipper transcription factor 1 novel protein coding ENST00000568262 596 324 UTR3 Trans
TCONS_00166381 GRB2-related adaptor protein 2 novel protein coding ENST00000568262 517 303 UTR3 Trans
TCONS_00168219 THO complex 5 novel protein coding ENST00000568262 626 272 UTR3 Trans
TCONS_00168220 THO complex 5 novel protein coding ENST00000568262 626 272 UTR3 Trans
TCONS_00173891 RNA, U6 small nuclear 461, pseudogene novel protein coding ENST00000568262 521 287 UTR3 Trans
TCONS_00184373 neutral cholesterol ester hydrolase 1 novel protein coding ENST00000568262 612 320 UTR3 Trans
TCONS_00185516 transcribed_unprocessed_pseudogene novel protein coding ENST00000568262 616 298 UTR3 Trans
TCONS_00185519 transcribed_unprocessed_pseudogene novel protein coding ENST00000568262 616 298 UTR3 Trans
TCONS_00186316 KIAA0232 novel protein coding ENST00000568262 622 292 UTR5 Trans
TCONS_00186316 KIAA0232 novel protein coding ENST00000568262 667 277 UTR3 Trans
TCONS_00202516 family with sequence similarity 173, member B novel protein coding ENST00000568262 623 305 UTR3 Trans
TCONS_00202516 family with sequence similarity 173, member B novel protein coding ENST00000568262 610 293 UTR5 Trans
TCONS_00202828 myotubularin related protein 12 novel protein coding ENST00000568262 632 302 UTR3 Trans
TCONS_00204896 erythrocyte membrane protein band 4.1 like 4A novel protein coding ENST00000568262 633 278 UTR5 Trans
TCONS_00205414 prolyl 4-hydroxylase, alpha polypeptide II novel protein coding ENST00000568262 629 315 UTR3 Trans
TCONS_00239255 tumor protein D52 novel protein coding ENST00000568262 614 308 UTR3 Trans
TCONS_00243477 osteoclast stimulating factor 1 novel protein coding ENST00000568262 606 294 UTR5 Trans
TCONS_00243482 osteoclast stimulating factor 1 novel protein coding ENST00000568262 606 294 UTR5 Trans
TCONS_00249683 suppressor of cancer cell invasion novel protein coding ENST00000568262 642 297 UTR3 Trans
TCONS_00251973 G protein-coupled receptor 34 novel protein coding ENST00000568262 633 289 UTR3 Trans

Sequence

>TCONS_00251973 (1023 nt)
GCTGGGCGTGGTGGCGGGCACCTGTAATCCCAGCTACTCAGGAGGCTGAGGCAGGAGAACTGCTTGAATTGCTTGAACCTGGGAGGCGAAGGTTGTAGTG
AGCAGAGATCGTGCCACTACACTCCAGCCTAGGTGACAGAGACTCTGTCTCAAAAAACAAACAAAAAAACAAAACAAAAAAAAACAGTTGGACTTGAATG
TTTTTAACTGGGCCCCATCACTCCTTTTTGAATAGTTTGTGTTGCCAGTCACACCCTGTAGGGTTTGTAGCCTGACTTTTCAAGCAGTGTGGTGGTAGGG
AGTCCAAGGAAGTTGAGTGGACTGTTTTGGACGTCTTTGGAGGAATTGGTGTGGATGGGTAATGACTTAGTATTTCATTGAAATGTTCATTTCTCTCGAG
TTATTTCTGGCAGAGGATAGCTCTAGTAGTCCCCTTCTCTTTTCCAAACACCTTTACCTTTGTCCTAATGAAAGTACTTAGTTATCTCTTTGGGCAGATG
CTATTTCTCTAGCTAAATTAACATGTCATCATTCACAGTTGGAAAACTGTGGCTGTGCTTTTTCATTTTTAGAGAAATGTTTTTAAAATACAGAAAAGAG
GCTGGGCGCAGTGGCTCACACCTGTAATCCCAGCACTTTGGGAGGCCGAGGTGGGTGAGTCACTTGAGGTCAGGAGTTTAAGACCAGCCTGGCCAACATG
GTGAAACCCTGTCTCTACTGAAAATACAAATATTTAGCTGGGCATGGTGGCGCGCACCTGTAATCCCAGCTACTTGGGAGGCTAAGGGAGGAGAATCGCT
TGAAAGTGGGAGGCGGAGGTTGCAGTGAGCTGAGATTGCACCGCTGCACTCCAGCCTGGGCAACAGAGAGAGACTCCAGCTCAGAAAAAATAAAAATAAA
ATACAGAAAAGAAAGAGAATAACTGTCACAAACCCATATATCCATCACTGAGAAGTGGCAATTGTAAATATTTTGTAATTTGCTTTAATTTTTTTAAATA
AAAGAAATAAAGTTTATTCACAGC

Expression



Full and truncated open reading frames discovered in TCONS_00251973

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.