Detailed information on ENST00000568692

lncRNA-RNA interactions

Number of interactions: 105

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000263955 serine/threonine kinase 17b protein coding ENST00000568692 674 280 UTR3 Trans
ENST00000276431 tumor necrosis factor receptor superfamily, member 10b protein coding ENST00000568692 552 254 UTR3 Trans
ENST00000338758 parvin, beta protein coding ENST00000568692 636 273 UTR3 Trans
ENST00000357613 transmembrane protein 170A protein coding ENST00000568692 628 261 UTR3 Trans
ENST00000367619 sterol O-acyltransferase 1 protein coding ENST00000568692 609 246 UTR3 Trans
ENST00000397755 zinc finger family member 788 processed transcript ENST00000568692 602 276 noncoding Trans
ENST00000418314 mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase protein coding ENST00000568692 505 270 CDS Trans
ENST00000448612 WD repeat domain 27 protein coding ENST00000568692 599 290 CDS Trans
ENST00000491277 protein tyrosine phosphatase, non-receptor type 14 processed transcript ENST00000568692 610 285 noncoding Trans
ENST00000494969 colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) protein coding ENST00000568692 611 280 CDS Trans
ENST00000517408 antisense antisense ENST00000568692 574 283 noncoding Trans
ENST00000527227 NAD synthetase 1 retained intron ENST00000568692 528 259 noncoding Trans
ENST00000530055 NAD synthetase 1 protein coding ENST00000568692 528 259 UTR5 Trans
ENST00000568559 transmembrane protein 170A nonsense mediated decay ENST00000568692 628 261 UTR3 Trans
ENST00000569540 transmembrane protein 170A protein coding ENST00000568692 628 261 UTR3 Trans
ENST00000572705 transient receptor potential cation channel, subfamily V, member 1 protein coding ENST00000568692 607 264 UTR3 Trans
ENST00000593250 centrosomal protein 76kDa nonsense mediated decay ENST00000568692 584 286 UTR3 Trans
ENST00000613994 tubby like protein 4 processed transcript ENST00000568692 508 188 noncoding Trans
ENST00000620139 melanoregulin protein coding ENST00000568692 596 284 UTR3 Trans
TCONS_00025758 zinc finger, MIZ-type containing 1 novel protein coding ENST00000568692 613 287 UTR5 Trans
TCONS_00025760 zinc finger, MIZ-type containing 1 novel protein coding ENST00000568692 613 287 UTR5 Trans
TCONS_00025761 zinc finger, MIZ-type containing 1 novel protein coding ENST00000568692 613 287 UTR5 Trans
TCONS_00027001 programmed cell death 4 (neoplastic transformation inhibitor) novel protein coding ENST00000568692 677 285 UTR3 Trans
TCONS_00027009 programmed cell death 4 (neoplastic transformation inhibitor) novel protein coding ENST00000568692 677 285 UTR3 Trans
TCONS_00030130 calcium/calmodulin-dependent protein kinase II gamma novel protein coding ENST00000568692 671 284 UTR3 Trans
TCONS_00030591 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000568692 604 266 UTR3 Trans
TCONS_00034642 CD82 molecule novel protein coding ENST00000568692 604 289 UTR3 Trans
TCONS_00034643 CD82 molecule novel protein coding ENST00000568692 604 289 UTR3 Trans
TCONS_00034643 CD82 molecule novel protein coding ENST00000568692 612 281 UTR3 Trans
TCONS_00037379 NAD synthetase 1 novel protein coding ENST00000568692 528 259 UTR5 Trans
TCONS_00037380 NAD synthetase 1 novel protein coding ENST00000568692 528 259 UTR5 Trans
TCONS_00065093 UBA domain containing 2 novel protein coding ENST00000568692 670 270 UTR5 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding ENST00000568692 619 282 UTR5 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding ENST00000568692 670 270 UTR5 Trans
TCONS_00065097 UBA domain containing 2 novel protein coding ENST00000568692 619 282 UTR3 Trans
TCONS_00065103 UBA domain containing 2 novel protein coding ENST00000568692 619 282 UTR5 Trans
TCONS_00065103 UBA domain containing 2 novel protein coding ENST00000568692 670 270 UTR5 Trans
TCONS_00067572 DCN1, defective in cullin neddylation 1, domain containing 2 novel protein coding ENST00000568692 625 287 UTR3 Trans
TCONS_00070307 pecanex homolog (Drosophila) novel protein coding ENST00000568692 638 282 UTR5 Trans
TCONS_00082423 transcribed_processed_pseudogene novel protein coding ENST00000568692 605 281 UTR3 Trans
TCONS_00098644 fatty acid 2-hydroxylase novel protein coding ENST00000568692 602 291 UTR3 Trans
TCONS_00098645 fatty acid 2-hydroxylase novel protein coding ENST00000568692 602 291 UTR3 Trans
TCONS_00098647 fatty acid 2-hydroxylase novel protein coding ENST00000568692 602 291 UTR3 Trans
TCONS_00098745 transmembrane protein 170A novel protein coding ENST00000568692 628 261 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000568692 607 264 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000568692 602 278 UTR5 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000568692 602 278 UTR3 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000568692 628 283 UTR3 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000568692 664 282 UTR3 Trans
TCONS_00107867 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000568692 628 283 UTR3 Trans
TCONS_00107867 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000568692 664 282 UTR3 Trans
TCONS_00108999 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000568692 613 286 UTR5 Trans
TCONS_00108999 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000568692 605 282 UTR5 Trans
TCONS_00109000 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000568692 605 282 UTR5 Trans
TCONS_00109000 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000568692 613 286 UTR5 Trans
TCONS_00109009 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000568692 605 282 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000568692 586 285 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000568692 605 282 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000568692 613 286 UTR3 Trans
TCONS_00109012 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000568692 605 282 UTR5 Trans
TCONS_00109012 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000568692 613 286 UTR3 Trans
TCONS_00109013 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000568692 613 286 UTR3 Trans
TCONS_00109013 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000568692 605 282 UTR5 Trans
TCONS_00109014 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000568692 613 286 UTR3 Trans
TCONS_00109014 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000568692 605 282 UTR5 Trans
TCONS_00109427 serine hydroxymethyltransferase 1 (soluble) novel protein coding ENST00000568692 653 274 UTR3 Trans
TCONS_00118358 l(3)mbt-like 4 (Drosophila) novel protein coding ENST00000568692 642 282 UTR3 Trans
TCONS_00118361 l(3)mbt-like 4 (Drosophila) novel protein coding ENST00000568692 642 282 UTR3 Trans
TCONS_00118919 potassium channel tetramerization domain containing 1 novel protein coding ENST00000568692 618 282 UTR3 Trans
TCONS_00119512 zinc finger and BTB domain containing 7C novel protein coding ENST00000568692 536 281 UTR3 Trans
TCONS_00124891 zinc finger protein 540 novel protein coding ENST00000568692 649 288 UTR3 Trans
TCONS_00137691 FOS-like antigen 2 novel protein coding ENST00000568692 648 290 UTR5 Trans
TCONS_00140732 NCK adaptor protein 2 novel protein coding ENST00000568692 639 287 UTR5 Trans
TCONS_00141404 GLI family zinc finger 2 novel protein coding ENST00000568692 651 256 UTR5 Trans
TCONS_00147093 ATPase family, AAA domain containing 2B novel protein coding ENST00000568692 619 291 UTR3 Trans
TCONS_00147093 ATPase family, AAA domain containing 2B novel protein coding ENST00000568692 623 277 UTR3 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding ENST00000568692 613 278 UTR3 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding ENST00000568692 606 268 UTR3 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding ENST00000568692 623 277 UTR3 Trans
TCONS_00147106 ATPase family, AAA domain containing 2B novel protein coding ENST00000568692 623 277 UTR3 Trans
TCONS_00148048 potassium voltage-gated channel, subfamily G, member 3 novel protein coding ENST00000568692 608 291 UTR3 Trans
TCONS_00148698 WD repeat containing planar cell polarity effector novel noncoding ENST00000568692 677 295 noncoding Trans
TCONS_00148704 WD repeat containing planar cell polarity effector novel protein coding ENST00000568692 677 295 UTR3 Trans
TCONS_00148705 WD repeat containing planar cell polarity effector novel protein coding ENST00000568692 677 295 UTR3 Trans
TCONS_00153158 serine/threonine kinase 17b novel protein coding ENST00000568692 674 280 UTR3 Trans
TCONS_00161618 interferon gamma receptor 2 (interferon gamma transducer 1) novel protein coding ENST00000568692 623 265 UTR3 Trans
TCONS_00184374 neutral cholesterol ester hydrolase 1 novel protein coding ENST00000568692 635 300 UTR3 Trans
TCONS_00185321 transferrin receptor novel protein coding ENST00000568692 650 282 UTR5 Trans
TCONS_00186316 KIAA0232 novel protein coding ENST00000568692 621 274 UTR5 Trans
TCONS_00195828 LRP2 binding protein novel protein coding ENST00000568692 627 277 UTR5 Trans
TCONS_00202828 myotubularin related protein 12 novel protein coding ENST00000568692 656 284 UTR3 Trans
TCONS_00203663 ribosomal protein L3 pseudogene 6 novel protein coding ENST00000568692 589 287 UTR3 Trans
TCONS_00203663 ribosomal protein L3 pseudogene 6 novel protein coding ENST00000568692 553 251 UTR3 Trans
TCONS_00203984 family with sequence similarity 169, member A novel protein coding ENST00000568692 624 264 UTR5 Trans
TCONS_00203985 family with sequence similarity 169, member A novel protein coding ENST00000568692 624 264 UTR5 Trans
TCONS_00203988 family with sequence similarity 169, member A novel noncoding ENST00000568692 624 264 noncoding Trans
TCONS_00213191 tubby like protein 4 novel protein coding ENST00000568692 628 282 UTR5 Trans
TCONS_00221037 POU class 6 homeobox 2 novel noncoding ENST00000568692 612 275 noncoding Trans
TCONS_00230128 solute carrier family 26 (anion exchanger), member 5 novel protein coding ENST00000568692 615 262 UTR3 Trans
TCONS_00233718 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2 novel protein coding ENST00000568692 611 285 UTR5 Trans
TCONS_00234854 zinc finger and BTB domain containing 10 novel protein coding ENST00000568692 629 263 UTR3 Trans
TCONS_00239255 tumor protein D52 novel protein coding ENST00000568692 616 297 UTR5 Trans
TCONS_00239255 tumor protein D52 novel protein coding ENST00000568692 651 262 UTR3 Trans
TCONS_00249092 transmembrane protein 245 novel protein coding ENST00000568692 675 281 UTR5 Trans
TCONS_00252827 discs, large homolog 3 (Drosophila) novel protein coding ENST00000568692 652 286 UTR5 Trans

Sequence

>TCONS_00252827 (635 nt)
GGCGAGCGTTTGGGGGTCCTCAGAGCCCTCTTCTTTAAGGTCATCAAGGATTACCCTTCCAACGAAGACCTTCACGAAAGGCTGGAGGTTTTCAAGGCCC
TCACAGACAATGGGAGACACATCACCTACTTGGAGGAAGAGCTGGCTGACTTTGTCCTGCAGTGGATGGATGTTGGCTTGTCCTCGGAATTCCTTCTGGT
GCTGGTGAACTTGGTCAAATTCAATAGCTGTTACCTCGACGAGTACATCGCAAGGATGGTTCAGTAAGAAAAGAATTGAGATCCTGTTCTGATAATGGTC
CTAAGTTCAGCTCCGCAGTGAATAAAGTTGAAACCACCAAAAAAATAGAGGTTGGGCTGGGCACAATGGCTCACGCCTGTAATCTCAGCACTTTGGGAGG
CCGAGGCAGGCGGATCACGAGGTCAGGAGTTCGAGACCAGCCTGGCCAACATGGTGAAACCCTGTCTCTACTAAAAATACAAAAATTAGCCGGGCATGGT
GGTGGGAGCCTGTAATCCCAGCTACTCAGGAGGCTGAGGCAGGAGAATTGCTTGAAACCGGAAGGCAGAGGTTGCAGTGAGCGGAGATCGTGCCACTGCA
CTCCAGCCTGGGTGAAAGAGCAAAACTCCATCTCAA

Expression



Full and truncated open reading frames discovered in TCONS_00252827

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.