Detailed information on ENST00000570505

lncRNA-RNA interactions

Number of interactions: 60

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000261653 syntaxin 2 protein coding ENST00000570505 504 296 UTR3 Trans
ENST00000263955 serine/threonine kinase 17b protein coding ENST00000570505 600 293 UTR3 Trans
ENST00000324537 SH3-domain GRB2-like 3 protein coding ENST00000570505 570 293 UTR5 Trans
ENST00000338758 parvin, beta protein coding ENST00000570505 641 286 UTR3 Trans
ENST00000357164 GM2 ganglioside activator protein coding ENST00000570505 595 292 UTR3 Trans
ENST00000361228 Ras association (RalGDS/AF-6) domain family (N-terminal) member 9 protein coding ENST00000570505 566 299 UTR3 Trans
ENST00000381431 sarcoglycan, beta (43kDa dystrophin-associated glycoprotein) protein coding ENST00000570505 613 294 UTR3 Trans
ENST00000392373 syntaxin 2 protein coding ENST00000570505 504 296 UTR3 Trans
ENST00000394622 STEAP family member 2, metalloreductase protein coding ENST00000570505 637 299 UTR3 Trans
ENST00000427746 holocarboxylase synthetase (biotin-(proprionyl-CoA-carboxylase (ATP-hydrolysing)) ligase) protein coding ENST00000570505 580 297 UTR5 Trans
ENST00000448612 WD repeat domain 27 protein coding ENST00000570505 585 301 CDS Trans
ENST00000475187 THO complex 5 retained intron ENST00000570505 571 297 noncoding Trans
ENST00000511184 E74-like factor 2 (ets domain transcription factor) nonsense mediated decay ENST00000570505 621 297 CDS_UTR Trans
ENST00000549365 DNA-damage regulated autophagy modulator 1 nonsense mediated decay ENST00000570505 514 299 CDS_UTR Trans
ENST00000568559 transmembrane protein 170A nonsense mediated decay ENST00000570505 571 259 UTR3 Trans
ENST00000588483 tropomyosin 4 protein coding ENST00000570505 647 298 UTR5 Trans
ENST00000604000 Lix1 homolog (chicken) like protein coding ENST00000570505 610 295 UTR3 Trans
TCONS_00050195 FYVE, RhoGEF and PH domain containing 4 novel protein coding ENST00000570505 669 295 UTR5 Trans
TCONS_00053851 transmembrane protein 263 novel protein coding ENST00000570505 666 285 UTR3 Trans
TCONS_00061878 transmembrane protein 116 novel protein coding ENST00000570505 600 293 UTR3 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding ENST00000570505 612 286 UTR5 Trans
TCONS_00065097 UBA domain containing 2 novel protein coding ENST00000570505 612 286 UTR3 Trans
TCONS_00065103 UBA domain containing 2 novel protein coding ENST00000570505 612 286 UTR5 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000570505 641 298 UTR3 Trans
TCONS_00107867 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000570505 641 298 UTR3 Trans
TCONS_00119512 zinc finger and BTB domain containing 7C novel protein coding ENST00000570505 573 281 UTR3 Trans
TCONS_00124891 zinc finger protein 540 novel protein coding ENST00000570505 663 291 UTR3 Trans
TCONS_00132233 zinc finger protein 43 novel protein coding ENST00000570505 615 295 UTR5 Trans
TCONS_00140732 NCK adaptor protein 2 novel protein coding ENST00000570505 609 291 UTR5 Trans
TCONS_00148698 WD repeat containing planar cell polarity effector novel noncoding ENST00000570505 615 276 noncoding Trans
TCONS_00148704 WD repeat containing planar cell polarity effector novel protein coding ENST00000570505 615 276 UTR3 Trans
TCONS_00148705 WD repeat containing planar cell polarity effector novel protein coding ENST00000570505 615 276 UTR3 Trans
TCONS_00150045 ankyrin repeat domain 36C novel protein coding ENST00000570505 612 284 UTR3 Trans
TCONS_00150051 ankyrin repeat domain 36C novel protein coding ENST00000570505 612 284 UTR3 Trans
TCONS_00153158 serine/threonine kinase 17b novel protein coding ENST00000570505 600 293 UTR3 Trans
TCONS_00161482 BTB and CNC homology 1, basic leucine zipper transcription factor 1 novel protein coding ENST00000570505 600 296 UTR3 Trans
TCONS_00163348 runt-related transcription factor 1 novel protein coding ENST00000570505 628 298 UTR3 Trans
TCONS_00163350 runt-related transcription factor 1 novel protein coding ENST00000570505 628 298 UTR3 Trans
TCONS_00163352 runt-related transcription factor 1 novel protein coding ENST00000570505 628 298 UTR3 Trans
TCONS_00168219 THO complex 5 novel protein coding ENST00000570505 609 296 UTR3 Trans
TCONS_00168220 THO complex 5 novel protein coding ENST00000570505 609 296 UTR3 Trans
TCONS_00173724 cms1 ribosomal small subunit homolog (yeast) novel protein coding ENST00000570505 606 297 UTR5 Trans
TCONS_00173729 cms1 ribosomal small subunit homolog (yeast) novel protein coding ENST00000570505 606 297 UTR5 Trans
TCONS_00173730 cms1 ribosomal small subunit homolog (yeast) novel protein coding ENST00000570505 606 297 UTR5 Trans
TCONS_00173891 RNA, U6 small nuclear 461, pseudogene novel protein coding ENST00000570505 579 286 UTR3 Trans
TCONS_00186316 KIAA0232 novel protein coding ENST00000570505 600 286 UTR5 Trans
TCONS_00194682 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000570505 603 291 UTR3 Trans
TCONS_00194682 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000570505 621 297 UTR3 Trans
TCONS_00194686 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000570505 603 291 UTR3 Trans
TCONS_00194686 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000570505 621 297 UTR3 Trans
TCONS_00200901 GM2 ganglioside activator novel protein coding ENST00000570505 595 292 UTR3 Trans
TCONS_00200902 GM2 ganglioside activator novel protein coding ENST00000570505 595 292 UTR3 Trans
TCONS_00222403 protein tyrosine phosphatase, non-receptor type 12 novel protein coding ENST00000570505 607 290 UTR5 Trans
TCONS_00225244 family with sequence similarity 115, member C novel protein coding ENST00000570505 613 290 UTR3 Trans
TCONS_00225246 family with sequence similarity 115, member C novel protein coding ENST00000570505 613 290 UTR3 Trans
TCONS_00239255 tumor protein D52 novel protein coding ENST00000570505 630 294 UTR3 Trans
TCONS_00239255 tumor protein D52 novel protein coding ENST00000570505 630 302 UTR3 Trans
TCONS_00243477 osteoclast stimulating factor 1 novel protein coding ENST00000570505 627 298 UTR5 Trans
TCONS_00243482 osteoclast stimulating factor 1 novel protein coding ENST00000570505 627 298 UTR5 Trans
TCONS_00249092 transmembrane protein 245 novel protein coding ENST00000570505 609 282 UTR5 Trans

Sequence

>TCONS_00249092 (527 nt)
ACTGAATGCCGTAAATAAGGGGCTCTACAGAGAGGCCACAGAGCTGTGGGGGAAAGCAGAAATGATCATTGAACAGAACACAGATGGGGTGAACTTCTAT
AACATCTTAACTAAAAGCACTCCCACGTCTACAATGGAGTCGAGTCTAGAATTCACACAGAGCCACCTAGCTGAATCTGAAACCCTCCCTCTTGCTGTGC
AGCATCCCCAGCAGCTTGGTAAAGATGTCCTCATGGCCAGGCGTGGTGGCTCACACCTGTAATCCCACCACTTGGGAGGCTGAGGCGGGTGGATCATGAG
GACAAGAGATCGAGACCATCCTGGCCAACATGGTGAAACCCTGTCTCTACTAAAAATACAAAAATGAGCTGGGCATGGTGGCGGGTGCCTGTAGTTCCAG
CTACTCGGGAGGCTGAGGCAGGAAAATCGCTTGAACCCAGGAGGCGGAGGTTTCAGTGAGCCGAGATCGTGCCACTGCACTCCAGCCTGGAGACAGAGAG
AGATTCTGTCTCAAAAAAAAAAAAAAAA

Expression



Full and truncated open reading frames discovered in TCONS_00249092

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.