| Potential function | Interacting transcript | Gene description | Transcript biotype | lncRNA id | Alignment score (LAST) | Alignment length | Transcript region involved in interaction | Genomic orientation of interacting RNAs |
|---|---|---|---|---|---|---|---|---|
| ENST00000324537 | SH3-domain GRB2-like 3 | protein coding | ENST00000571023 | 553 | 270 | UTR5 | Trans | |
| ENST00000338758 | parvin, beta | protein coding | ENST00000571023 | 621 | 267 | UTR3 | Trans | |
| ENST00000448612 | WD repeat domain 27 | protein coding | ENST00000571023 | 550 | 273 | CDS | Trans | |
| ENST00000588483 | tropomyosin 4 | protein coding | ENST00000571023 | 575 | 267 | UTR5 | Trans | |
| ENST00000620139 | melanoregulin | protein coding | ENST00000571023 | 553 | 266 | UTR3 | Trans | |
| TCONS_00050195 | FYVE, RhoGEF and PH domain containing 4 | novel protein coding | ENST00000571023 | 609 | 267 | UTR5 | Trans | |
| TCONS_00053851 | transmembrane protein 263 | novel protein coding | ENST00000571023 | 655 | 268 | UTR3 | Trans | |
| TCONS_00075813 | forkhead box N3 | novel protein coding | ENST00000571023 | 641 | 268 | UTR5 | Trans | |
| TCONS_00075827 | forkhead box N3 | novel protein coding | ENST00000571023 | 641 | 268 | UTR3 | Trans | |
| TCONS_00119512 | zinc finger and BTB domain containing 7C | novel protein coding | ENST00000571023 | 605 | 292 | UTR3 | Trans | |
| TCONS_00124891 | zinc finger protein 540 | novel protein coding | ENST00000571023 | 628 | 268 | UTR3 | Trans | |
| TCONS_00147100 | ATPase family, AAA domain containing 2B | novel protein coding | ENST00000571023 | 654 | 269 | UTR3 | Trans | |
| TCONS_00147113 | ATPase family, AAA domain containing 2B | novel protein coding | ENST00000571023 | 654 | 269 | UTR3 | Trans | |
| TCONS_00147115 | ATPase family, AAA domain containing 2B | novel protein coding | ENST00000571023 | 654 | 269 | UTR3 | Trans | |
| TCONS_00148698 | WD repeat containing planar cell polarity effector | novel noncoding | ENST00000571023 | 629 | 290 | noncoding | Trans | |
| TCONS_00148704 | WD repeat containing planar cell polarity effector | novel protein coding | ENST00000571023 | 629 | 290 | UTR3 | Trans | |
| TCONS_00148705 | WD repeat containing planar cell polarity effector | novel protein coding | ENST00000571023 | 629 | 290 | UTR3 | Trans | |
| TCONS_00184374 | neutral cholesterol ester hydrolase 1 | novel protein coding | ENST00000571023 | 661 | 405 | UTR3 | Trans | |
| TCONS_00194682 | E74-like factor 2 (ets domain transcription factor) | novel protein coding | ENST00000571023 | 613 | 261 | UTR3 | Trans | |
| TCONS_00194686 | E74-like factor 2 (ets domain transcription factor) | novel protein coding | ENST00000571023 | 613 | 261 | UTR3 | Trans | |
| TCONS_00226448 | collagen, type XXVIII, alpha 1 | novel protein coding | ENST00000571023 | 518 | 268 | UTR5 | Trans | |
| TCONS_00226450 | collagen, type XXVIII, alpha 1 | novel protein coding | ENST00000571023 | 518 | 268 | UTR5 | Trans | |
| TCONS_00226462 | lincRNA | novel noncoding | ENST00000571023 | 518 | 268 | noncoding | Trans | |
| TCONS_00226463 | lincRNA | novel noncoding | ENST00000571023 | 518 | 268 | noncoding | Trans | |
| TCONS_00226468 | lincRNA | novel noncoding | ENST00000571023 | 518 | 268 | noncoding | Trans | |
| TCONS_00247058 | UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 | novel protein coding | ENST00000571023 | 619 | 418 | UTR3 | Trans |
>TCONS_00247058 (578 nt)
CAAGATGGCGGACCTACTGGGCTCCATCCTGAGCTCCATGGAGAAGCCACCCAGCCTCGGTGACCAGGAGACTCGGCGCAAGGCCCGAGATGCAGAGAAG
ACTCGAAAACCAGTTAAAGAACAGTCAGTGGGGCCCGGCCTTGTAGCTCACACCTTTAATACCACCACTTTGGGAGGCCGCGGCGGACGGATCGCTTGAG
CCCAGGAGTTCAAGACCAGTCTGGGCAACATGGAGAAACCCCATCTCTACAAAAAATACAAAAATTGGCCGGGCTCACGCCTGTAATCCCAAAACTTTGG
GAGGCCAAGGCGGGCAGATCACGAGATCAAGAGATCGAGAGCATCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAATACGAAAATTAGCTGGGCG
TGGTGGCGCGTGCCTGTAGTCCCAGCTACTCAGGAGGCTGGGGCAGGAGAATCAGTTGAACCCAGGAGGAGGAGGTTGCAGTGAGCCGAGATTGCGCCAC
TGTACTCCAGCCTGGCGACAGAGCGAGACTCCGTCTCATAAATAAATAAATAAATAGATAAATAAATAAATAAATAAAT
In silico ORF/peptide predictions
Nothing found.
RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.