Detailed information on ENST00000576477

lncRNA-RNA interactions

Number of interactions: 59

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000323699 delta(4)-desaturase, sphingolipid 1 protein coding ENST00000576477 557 218 UTR3 Trans
ENST00000391877 delta(4)-desaturase, sphingolipid 1 protein coding ENST00000576477 557 218 UTR3 Trans
ENST00000422247 centrosomal protein 135kDa protein coding ENST00000576477 617 279 UTR3 Trans
ENST00000424496 sense_intronic sense intronic ENST00000576477 566 278 noncoding Trans
ENST00000439138 transmembrane protein 98 protein coding ENST00000576477 607 281 UTR5 Trans
ENST00000478730 ORAI calcium release-activated calcium modulator 2 protein coding ENST00000576477 619 278 UTR3 Trans
ENST00000484457 F-box and leucine-rich repeat protein 2 protein coding ENST00000576477 604 258 UTR3 Trans
ENST00000498813 delta(4)-desaturase, sphingolipid 1 processed transcript ENST00000576477 576 282 noncoding Trans
ENST00000560870 sense_intronic sense intronic ENST00000576477 585 258 noncoding Trans
TCONS_00009834 SRY (sex determining region Y)-box 13 novel protein coding ENST00000576477 602 276 UTR3 Trans
TCONS_00011236 solute carrier family 35, member F3 novel protein coding ENST00000576477 616 281 UTR3 Trans
TCONS_00023682 pre-mRNA processing factor 18 novel protein coding ENST00000576477 623 280 UTR3 Trans
TCONS_00023685 pre-mRNA processing factor 18 novel protein coding ENST00000576477 623 280 UTR3 Trans
TCONS_00023687 pre-mRNA processing factor 18 novel protein coding ENST00000576477 623 280 UTR3 Trans
TCONS_00023689 pre-mRNA processing factor 18 novel protein coding ENST00000576477 623 280 UTR3 Trans
TCONS_00028040 ankyrin repeat domain 16 novel protein coding ENST00000576477 620 278 UTR3 Trans
TCONS_00030130 calcium/calmodulin-dependent protein kinase II gamma novel protein coding ENST00000576477 605 280 UTR3 Trans
TCONS_00030588 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000576477 627 278 UTR3 Trans
TCONS_00030588 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000576477 602 277 UTR3 Trans
TCONS_00030591 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000576477 602 277 UTR3 Trans
TCONS_00039782 GRAM domain containing 1B novel protein coding ENST00000576477 612 278 UTR5 Trans
TCONS_00053503 anoctamin 4 novel protein coding ENST00000576477 618 282 UTR3 Trans
TCONS_00053513 anoctamin 4 novel protein coding ENST00000576477 618 282 UTR5 Trans
TCONS_00053851 transmembrane protein 263 novel protein coding ENST00000576477 613 280 UTR5 Trans
TCONS_00075840 forkhead box N3 novel protein coding ENST00000576477 646 257 UTR3 Trans
TCONS_00075841 forkhead box N3 novel protein coding ENST00000576477 646 257 UTR3 Trans
TCONS_00075917 ribosomal protein S6 kinase, 90kDa, polypeptide 5 novel noncoding ENST00000576477 609 279 noncoding Trans
TCONS_00088780 synaptotagmin XVII novel protein coding ENST00000576477 611 282 UTR3 Trans
TCONS_00095053 epithelial membrane protein 2 novel protein coding ENST00000576477 600 258 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000576477 612 278 UTR5 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000576477 612 278 UTR3 Trans
TCONS_00116668 desmoglein 3 novel protein coding ENST00000576477 548 278 UTR3 Trans
TCONS_00116668 desmoglein 3 novel protein coding ENST00000576477 645 280 UTR3 Trans
TCONS_00132233 zinc finger protein 43 novel protein coding ENST00000576477 633 273 UTR5 Trans
TCONS_00140732 NCK adaptor protein 2 novel protein coding ENST00000576477 605 282 UTR3 Trans
TCONS_00141667 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000576477 642 278 UTR3 Trans
TCONS_00141679 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000576477 642 278 UTR3 Trans
TCONS_00142157 LY6/PLAUR domain containing 6B novel noncoding ENST00000576477 608 282 noncoding Trans
TCONS_00142168 LY6/PLAUR domain containing 6B novel protein coding ENST00000576477 608 282 UTR3 Trans
TCONS_00142174 LY6/PLAUR domain containing 6B novel protein coding ENST00000576477 608 282 UTR3 Trans
TCONS_00147093 ATPase family, AAA domain containing 2B novel protein coding ENST00000576477 605 276 UTR3 Trans
TCONS_00147113 ATPase family, AAA domain containing 2B novel protein coding ENST00000576477 605 276 UTR5 Trans
TCONS_00161482 BTB and CNC homology 1, basic leucine zipper transcription factor 1 novel protein coding ENST00000576477 614 281 UTR3 Trans
TCONS_00171146 F-box and leucine-rich repeat protein 2 novel noncoding ENST00000576477 613 282 noncoding Trans
TCONS_00184373 neutral cholesterol ester hydrolase 1 novel protein coding ENST00000576477 634 283 UTR3 Trans
TCONS_00191796 G protein-coupled receptor 125 novel protein coding ENST00000576477 616 281 UTR5 Trans
TCONS_00191797 G protein-coupled receptor 125 novel protein coding ENST00000576477 616 281 UTR3 Trans
TCONS_00192322 tec protein tyrosine kinase novel protein coding ENST00000576477 606 282 UTR5 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000576477 622 263 UTR3 Trans
TCONS_00195633 aspartylglucosaminidase novel protein coding ENST00000576477 597 258 UTR3 Trans
TCONS_00202516 family with sequence similarity 173, member B novel protein coding ENST00000576477 616 269 UTR3 Trans
TCONS_00203984 family with sequence similarity 169, member A novel protein coding ENST00000576477 605 276 UTR5 Trans
TCONS_00203985 family with sequence similarity 169, member A novel protein coding ENST00000576477 605 276 UTR5 Trans
TCONS_00204911 erythrocyte membrane protein band 4.1 like 4A novel noncoding ENST00000576477 609 257 noncoding Trans
TCONS_00204916 erythrocyte membrane protein band 4.1 like 4A novel protein coding ENST00000576477 609 257 UTR3 Trans
TCONS_00211226 antisense novel protein coding ENST00000576477 621 281 UTR5 Trans
TCONS_00213191 tubby like protein 4 novel protein coding ENST00000576477 609 282 UTR5 Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000576477 608 281 UTR3 Trans
TCONS_00247058 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 novel protein coding ENST00000576477 602 275 UTR3 Trans

Sequence

>TCONS_00247058 (512 nt)
TGACGGAGTCTCACTCTATCGTGGAGGCTGGAGTGCAGTGGAGCAATCTCAGCTCACTACAACCTCTGCCTCCTGGATTCAAGAAATTCTCCTGCCTCAG
CCTCCCGAGTAGCTGGGATTACAGGTGCCTGTCACCACGCCCGGCTAATTTTTGTATTTTTAGTAGAGATGGGGTTACACCATGTTGGCCAGGCTGGTCT
CGAACTCCTGATCTCAGGTGATCCACCCGCCTCAGCTTCCCAAAGTGCTGGGATTATAGGTGTGAGCCACCGTGCCCGGCCTTTTACATGCTTTTAACTC
ATTTGATCCTCACAACAAACTCTGTGAGGTGGGTTCTTATTTTTCCTACTTTATAAATGTGATAACTGAGGCGTACAGAAGTTAAGTAATTTGCCAAATC
CTAGAGGCTTCCAGAGCTCTCTGTCTTAATCACTAAGGCTATGCTGTAGGGTCTGGAGGGTGAAAGCAGTACCCAGCTTCAGGACTGCAACAGTGTTGCA
GAGGATCCAGTCT

Expression



Full and truncated open reading frames discovered in TCONS_00247058

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.