Detailed information on ENST00000580649

lncRNA-RNA interactions

Number of interactions: 113

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000242057 aryl hydrocarbon receptor protein coding ENST00000580649 522 299 UTR3 Trans
ENST00000257287 centrosomal protein 135kDa protein coding ENST00000580649 664 305 UTR3 Trans
ENST00000257696 hypoxia inducible lipid droplet-associated protein coding ENST00000580649 634 298 UTR3 Trans
ENST00000280154 programmed cell death 4 (neoplastic transformation inhibitor) protein coding ENST00000580649 529 299 UTR3 Trans
ENST00000309060 zinc fingers and homeoboxes 3 protein coding ENST00000580649 668 300 UTR3 Trans
ENST00000323699 delta(4)-desaturase, sphingolipid 1 protein coding ENST00000580649 538 292 UTR3 Trans
ENST00000338758 parvin, beta protein coding ENST00000580649 625 302 UTR3 Trans
ENST00000339732 polypeptide N-acetylgalactosaminyltransferase 15 protein coding ENST00000580649 646 297 UTR3 Trans
ENST00000358157 sphingosine-1-phosphate receptor 3 protein coding ENST00000580649 626 288 UTR3 Trans
ENST00000375846 sphingosine-1-phosphate receptor 3 protein coding ENST00000580649 626 288 UTR3 Trans
ENST00000389534 zinc finger protein 841 protein coding ENST00000580649 611 265 UTR3 Trans
ENST00000391877 delta(4)-desaturase, sphingolipid 1 protein coding ENST00000580649 538 292 UTR3 Trans
ENST00000421422 zinc fingers and homeoboxes 3 protein coding ENST00000580649 668 300 UTR3 Trans
ENST00000424496 sense_intronic sense intronic ENST00000580649 622 292 noncoding Trans
ENST00000426391 zinc finger protein 841 protein coding ENST00000580649 611 265 UTR3 Trans
ENST00000435296 hypoxia inducible lipid droplet-associated protein coding ENST00000580649 633 297 UTR3 Trans
ENST00000463496 aryl hydrocarbon receptor nonsense mediated decay ENST00000580649 522 299 UTR3 Trans
ENST00000478730 ORAI calcium release-activated calcium modulator 2 protein coding ENST00000580649 603 307 UTR3 Trans
ENST00000478730 ORAI calcium release-activated calcium modulator 2 protein coding ENST00000580649 651 298 UTR3 Trans
ENST00000490103 THO complex 5 protein coding ENST00000580649 509 284 UTR3 Trans
ENST00000506202 centrosomal protein 135kDa retained intron ENST00000580649 664 305 noncoding Trans
ENST00000513143 podoplanin protein coding ENST00000580649 626 299 UTR5 Trans
ENST00000513269 NEDD4 binding protein 2 protein coding ENST00000580649 572 290 UTR3 Trans
ENST00000552918 spermatogenesis associated, serine-rich 2 protein coding ENST00000580649 623 282 UTR3 Trans
ENST00000553127 spermatogenesis associated, serine-rich 2 protein coding ENST00000580649 659 299 UTR3 Trans
ENST00000594295 zinc finger protein 841 protein coding ENST00000580649 611 265 UTR3 Trans
ENST00000620139 melanoregulin protein coding ENST00000580649 623 299 UTR3 Trans
TCONS_00001821 low density lipoprotein receptor adaptor protein 1 novel protein coding ENST00000580649 616 285 UTR5 Trans
TCONS_00001823 low density lipoprotein receptor adaptor protein 1 novel protein coding ENST00000580649 616 285 UTR5 Trans
TCONS_00008758 flavin containing monooxygenase 4 novel protein coding ENST00000580649 546 299 UTR3 Trans
TCONS_00010077 Ras association (RalGDS/AF-6) domain family member 5 novel protein coding ENST00000580649 546 293 UTR3 Trans
TCONS_00011236 solute carrier family 35, member F3 novel protein coding ENST00000580649 611 299 UTR3 Trans
TCONS_00023682 pre-mRNA processing factor 18 novel protein coding ENST00000580649 638 299 UTR3 Trans
TCONS_00023685 pre-mRNA processing factor 18 novel protein coding ENST00000580649 638 299 UTR3 Trans
TCONS_00023687 pre-mRNA processing factor 18 novel protein coding ENST00000580649 638 299 UTR3 Trans
TCONS_00023689 pre-mRNA processing factor 18 novel protein coding ENST00000580649 638 299 UTR3 Trans
TCONS_00025760 zinc finger, MIZ-type containing 1 novel protein coding ENST00000580649 614 295 UTR5 Trans
TCONS_00025761 zinc finger, MIZ-type containing 1 novel protein coding ENST00000580649 614 295 UTR5 Trans
TCONS_00025775 zinc finger, MIZ-type containing 1 novel protein coding ENST00000580649 614 295 UTR5 Trans
TCONS_00030588 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000580649 597 301 UTR3 Trans
TCONS_00030588 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000580649 640 289 UTR3 Trans
TCONS_00030591 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000580649 671 302 UTR3 Trans
TCONS_00030592 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000580649 671 302 UTR3 Trans
TCONS_00037377 NAD synthetase 1 novel protein coding ENST00000580649 603 298 UTR3 Trans
TCONS_00039117 nicotinamide N-methyltransferase novel protein coding ENST00000580649 603 299 UTR3 Trans
TCONS_00041296 RIC3 acetylcholine receptor chaperone novel protein coding ENST00000580649 633 301 UTR3 Trans
TCONS_00041298 RIC3 acetylcholine receptor chaperone novel protein coding ENST00000580649 633 301 UTR3 Trans
TCONS_00050209 FYVE, RhoGEF and PH domain containing 4 novel protein coding ENST00000580649 627 299 UTR5 Trans
TCONS_00050741 spermatogenesis associated, serine-rich 2 novel protein coding ENST00000580649 659 299 UTR3 Trans
TCONS_00050741 spermatogenesis associated, serine-rich 2 novel protein coding ENST00000580649 602 299 UTR3 Trans
TCONS_00053851 transmembrane protein 263 novel protein coding ENST00000580649 645 300 UTR5 Trans
TCONS_00061864 transmembrane protein 116 novel protein coding ENST00000580649 631 297 UTR3 Trans
TCONS_00062678 hydroxycarboxylic acid receptor 3 novel protein coding ENST00000580649 610 290 UTR3 Trans
TCONS_00065859 ubiquitin specific peptidase 12 novel protein coding ENST00000580649 627 298 UTR3 Trans
TCONS_00065864 long intergenic non-protein coding RNA 412 novel protein coding ENST00000580649 642 299 UTR3 Trans
TCONS_00070064 gephyrin novel protein coding ENST00000580649 604 269 UTR3 Trans
TCONS_00075840 forkhead box N3 novel protein coding ENST00000580649 644 299 UTR3 Trans
TCONS_00075841 forkhead box N3 novel protein coding ENST00000580649 644 299 UTR3 Trans
TCONS_00076763 protein phosphatase 1, regulatory subunit 13B novel protein coding ENST00000580649 630 299 UTR3 Trans
TCONS_00090929 nucleoporin 93kDa novel protein coding ENST00000580649 589 300 UTR3 Trans
TCONS_00090939 nucleoporin 93kDa novel protein coding ENST00000580649 589 300 UTR3 Trans
TCONS_00090941 nucleoporin 93kDa novel protein coding ENST00000580649 589 300 UTR3 Trans
TCONS_00101146 myosin phosphatase Rho interacting protein novel protein coding ENST00000580649 634 300 UTR3 Trans
TCONS_00105791 arylsulfatase G novel protein coding ENST00000580649 616 298 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000580649 610 299 UTR5 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000580649 645 300 UTR5 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000580649 645 300 UTR3 Trans
TCONS_00117136 CBP80/20-dependent translation initiation factor novel protein coding ENST00000580649 585 300 UTR3 Trans
TCONS_00119478 zinc finger and BTB domain containing 7C novel protein coding ENST00000580649 635 300 UTR5 Trans
TCONS_00135631 zinc finger protein 841 novel protein coding ENST00000580649 611 265 UTR3 Trans
TCONS_00135631 zinc finger protein 841 novel protein coding ENST00000580649 628 292 UTR3 Trans
TCONS_00135644 zinc finger protein 841 novel protein coding ENST00000580649 611 265 UTR3 Trans
TCONS_00141667 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000580649 639 288 UTR3 Trans
TCONS_00141670 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000580649 604 304 UTR5 Trans
TCONS_00141673 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000580649 604 304 UTR5 Trans
TCONS_00141679 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000580649 604 304 UTR5 Trans
TCONS_00141679 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000580649 639 288 UTR3 Trans
TCONS_00147093 ATPase family, AAA domain containing 2B novel protein coding ENST00000580649 667 300 UTR3 Trans
TCONS_00147093 ATPase family, AAA domain containing 2B novel protein coding ENST00000580649 659 298 UTR3 Trans
TCONS_00147113 ATPase family, AAA domain containing 2B novel protein coding ENST00000580649 659 298 UTR5 Trans
TCONS_00148450 coiled-coil domain containing 88A novel protein coding ENST00000580649 617 303 UTR3 Trans
TCONS_00148450 coiled-coil domain containing 88A novel protein coding ENST00000580649 612 296 UTR3 Trans
TCONS_00160920 protein tyrosine kinase 6 novel protein coding ENST00000580649 606 298 UTR5 Trans
TCONS_00165341 TTC28 antisense RNA 1 novel protein coding ENST00000580649 612 291 UTR5 Trans
TCONS_00165715 LIM domain kinase 2 novel protein coding ENST00000580649 575 289 UTR3 Trans
TCONS_00165721 LIM domain kinase 2 novel protein coding ENST00000580649 575 289 UTR3 Trans
TCONS_00171146 F-box and leucine-rich repeat protein 2 novel noncoding ENST00000580649 605 289 noncoding Trans
TCONS_00184373 neutral cholesterol ester hydrolase 1 novel protein coding ENST00000580649 631 298 UTR3 Trans
TCONS_00190999 zinc finger protein 721 novel protein coding ENST00000580649 605 300 UTR3 Trans
TCONS_00192322 tec protein tyrosine kinase novel protein coding ENST00000580649 601 298 UTR5 Trans
TCONS_00194686 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000580649 654 289 UTR5 Trans
TCONS_00195633 aspartylglucosaminidase novel protein coding ENST00000580649 552 287 UTR3 Trans
TCONS_00196475 F-box and leucine-rich repeat protein 7 novel protein coding ENST00000580649 602 298 UTR3 Trans
TCONS_00202516 family with sequence similarity 173, member B novel protein coding ENST00000580649 619 290 UTR3 Trans
TCONS_00203985 family with sequence similarity 169, member A novel protein coding ENST00000580649 637 297 UTR5 Trans
TCONS_00209602 Uncharacterized protein {ECO:0000313|Ensembl:ENSP00000410815}; cDNA FLJ55673, highly similar to Complement factor B {ECO:0000313|EMBL:BAG64956.1} novel protein coding ENST00000580649 504 293 UTR3 Trans
TCONS_00211226 antisense novel protein coding ENST00000580649 603 298 UTR5 Trans
TCONS_00213191 tubby like protein 4 novel protein coding ENST00000580649 642 298 UTR5 Trans
TCONS_00213191 tubby like protein 4 novel protein coding ENST00000580649 600 295 UTR5 Trans
TCONS_00220258 aryl hydrocarbon receptor novel protein coding ENST00000580649 522 299 UTR3 Trans
TCONS_00233718 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2 novel protein coding ENST00000580649 653 289 UTR5 Trans
TCONS_00234826 zinc finger, C2HC-type containing 1A novel protein coding ENST00000580649 615 308 UTR3 Trans
TCONS_00235205 epithelial splicing regulatory protein 1 novel protein coding ENST00000580649 640 305 UTR3 Trans
TCONS_00235219 epithelial splicing regulatory protein 1 novel protein coding ENST00000580649 640 305 UTR3 Trans
TCONS_00235231 epithelial splicing regulatory protein 1 novel protein coding ENST00000580649 640 305 UTR3 Trans
TCONS_00240685 metastasis suppressor 1 novel protein coding ENST00000580649 557 234 UTR3 Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000580649 671 291 UTR5 Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000580649 637 300 UTR3 Trans
TCONS_00243477 osteoclast stimulating factor 1 novel protein coding ENST00000580649 637 299 UTR5 Trans
TCONS_00243482 osteoclast stimulating factor 1 novel protein coding ENST00000580649 637 299 UTR5 Trans
TCONS_00243503 proprotein convertase subtilisin/kexin type 5 novel protein coding ENST00000580649 594 298 UTR3 Trans
TCONS_00243507 proprotein convertase subtilisin/kexin type 5 novel protein coding ENST00000580649 594 298 UTR3 Trans
TCONS_00247058 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 novel protein coding ENST00000580649 603 289 UTR3 Trans

Sequence

>TCONS_00247058 (2190 nt)
TTGGTAGAGACGGGGTTTCGCCATGTTGCCCAGACTGGTCTCGAACTCCTGAGCTCAGGTGATCCACCCTCCTTGGCCTCCCAAAGTGCTGGGAGTACAG
GTGTGAGCCACCATGCCCAGCCTCTGCTTTTTTTAACTGTCCCTTATAGCTGTAATTTCTCATCCATCTATCCTCCTCTGATATTTACACAAGTCTCAAT
ATCCAGAGTTCATTTGCTTATTCATTCAAAGATGTGTATGGAGGGCCTACTCTGTGCCAGGTAGTGTTAAGTGCTGGAGCCATAACACTAAGCAGTCTTT
TTTTTTTTTTTTTGAGACGGAGTCTTGCTCTGTCGCCCAGGCTGGAGTGCAGTGGGGCCATCTCAGCTCACTGCAATCTCCGCCTCCCAGGTTCAAGCAG
TTCTCTTGCCTCAGCCTCCCATGTAGCTGGGACTACAGGTGCTGGCCACCTTGCACAGCTAATTTTTGTATTTTTAGTAGAGACGGGGTTTCACCATGTT
GGTCAGGCTGGTCTCGAACTCCCGACCTTAGGTGATCCGCCCGCCTCAGCCTCCCAAAGTGCTGGGATTACAGGCATGAGCCACCGCACCCGGCTAACAC
TAAGCAGTCTTCTAAGGAGACCATTCATTACGCAGTGCTCCTTCCACCAGTCAGCTCCCTAGGGTTCCATGCAGAAGAGAAATCAGAATTTCTTTACAAT
TCAAGGTGCTAAGAGGCCATTTTTTGGTCATCAAGTCCAGCTGTCCTTTTCAGATGAAGAAAATGAAGCTTATCATCATAAAGAATTGTCCAGGGTTCCG
AGTTAGTGATAGGGCTGAGAAGACCCTTGAGCTCCTGTTCCCAGTCTAATATTCTTTCTACTCCAGTATTGAGATGCGTATTCGTTTCCGCTTGGGACAC
AGAATGTCTTTCAGTATGACCTTTAAGGATTCGTAGCTTCCAGCCCTTTGAGCTCCTGGGTGTATTGGCGACGACTCACTGTCCTTGTGTTTGTAGTTTA
ATGCGCTGAAGGTTCCCGTGCCCTTGTGTTTGTAGTTTAATGCGCTGAAGGTTCCCGTGCCAGAGGATAAATATACTGCCCAGGTGGATGCCGAAGAAAA
AGAAGATGTAAGTAGTTGAGGCTCCTGCTTATTCTAAAATTCTCTTGATCTTGACAGCTCTCTATTATAGCTAAGTTAAGTTAGAGTGAATTAAATGGAA
GAGTTAACAGCCATATAAAGGAATGACTTGTCAATAAATGCAACAACATGGACGAATTTCAAAATAATTATGCGGAGTGAAAGAAGCCAACAAGAAAAAG
AAGAGTATAGCATATGATTCCATCTTTGTAAGACTCTAGAAAATGTAGTTTGTCTACAGTGGCTGCCTGGGGATGGTTGAGAGGGGACTGCTGGTTTCAC
AGGTGGATACCTATATCAAAACTTATCAAATGGTGTTCTTTAAATATGTGCATTTTATCATATTTCAGATATACCTCAACAAAGCTGTTAGAAACAAGGA
GTTGGAATTAGAAAAATTACCCAAGTAGTATTCAAATACCTAATTATTTGCTTGAAAGCACTGAAGGCCAACTATGGAACTCAGTGGCTCCACCAGAGAG
AAGTCTGGCTAGGTGCTCAGGTGGCGTGTCCTGACCATTCAGTGGCTGAGCCCTGTGAAAACAGGCATTCTGTAGGTCTTCGGATGAGGAACTTGCAGAA
GCAGCCGGGTGCTGCCATCCTAAGCTGGTTTTCCATATGGGCTTCTCTGTGAGTGTTAAGAAAAGCTGTGGTTTGCCTGTCAGAGTGAGCGCCCCCACTC
AGGGTAACCACAGTTTCTCCATAGAGCAATAGGACAGCAGGAGTGGGCTGGGACGACTCCTACCTTAGCAGCTGCTGGGGTAGAATGCAGCCTGGTTTCA
GAACTGAATTTCTCTTTCTTCTTAAAGGTGAAATCTTGTGCTGAGTGGGTGTCTCTCTCAAAGGCCAGGATTGTAGAATATGAGAAAGAGATGGAGAAGA
TGAAGAACTTAATTCCATTTGATCAGATGACCATTGAGGACTTGAATGAAGCTTTCCCAGAAACCAAATTAGACAAGAAAAAGTATCCCTATTGGCCTCA
CCAACCAATTGAGAATTTATAAAATTGAGTCCAGGAGGAAGCTCTGGCCCTTGTATTACACATTCTGGACATTAAAAATAATAATTATACA

Expression



Full and truncated open reading frames discovered in TCONS_00247058

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.