Detailed information on ENST00000582557

lncRNA-RNA interactions

Number of interactions: 70

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000280154 programmed cell death 4 (neoplastic transformation inhibitor) protein coding ENST00000582557 642 298 UTR3 Trans
ENST00000330676 TLC domain containing 2 protein coding ENST00000582557 622 301 UTR3 Trans
ENST00000339732 polypeptide N-acetylgalactosaminyltransferase 15 protein coding ENST00000582557 600 302 UTR3 Trans
ENST00000345714 serum/glucocorticoid regulated kinase family, member 3 protein coding ENST00000582557 683 299 UTR3 Trans
ENST00000407780 inducible T-cell co-stimulator ligand protein coding ENST00000582557 631 301 UTR3 Trans
ENST00000435296 hypoxia inducible lipid droplet-associated protein coding ENST00000582557 542 299 UTR3 Trans
ENST00000439138 transmembrane protein 98 protein coding ENST00000582557 528 293 UTR5 Trans
ENST00000478730 ORAI calcium release-activated calcium modulator 2 protein coding ENST00000582557 505 311 UTR3 Trans
ENST00000620340 ribosomal protein S6 kinase, 90kDa, polypeptide 6 protein coding ENST00000582557 622 305 UTR3 Trans
ENST00000621141 G protein-coupled receptor 1 protein coding ENST00000582557 592 287 UTR3 Trans
TCONS_00008385 nitric oxide synthase 1 (neuronal) adaptor protein novel protein coding ENST00000582557 620 296 UTR3 Trans
TCONS_00008758 flavin containing monooxygenase 4 novel protein coding ENST00000582557 670 300 UTR3 Trans
TCONS_00010841 epoxide hydrolase 1, microsomal (xenobiotic) novel protein coding ENST00000582557 651 299 UTR3 Trans
TCONS_00011236 solute carrier family 35, member F3 novel protein coding ENST00000582557 608 303 UTR3 Trans
TCONS_00017068 calponin 3, acidic novel protein coding ENST00000582557 559 304 UTR3 Trans
TCONS_00021902 protein tyrosine phosphatase, non-receptor type 14 novel protein coding ENST00000582557 660 299 UTR3 Trans
TCONS_00021903 protein tyrosine phosphatase, non-receptor type 14 novel protein coding ENST00000582557 660 299 UTR3 Trans
TCONS_00028040 ankyrin repeat domain 16 novel protein coding ENST00000582557 607 298 UTR3 Trans
TCONS_00030588 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000582557 647 294 UTR3 Trans
TCONS_00030591 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000582557 630 300 UTR3 Trans
TCONS_00030591 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000582557 598 297 UTR3 Trans
TCONS_00030592 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000582557 630 300 UTR3 Trans
TCONS_00043422 vacuolar protein sorting 37 homolog C (S. cerevisiae) novel protein coding ENST00000582557 696 300 UTR5 Trans
TCONS_00050192 FYVE, RhoGEF and PH domain containing 4 novel protein coding ENST00000582557 670 297 UTR5 Trans
TCONS_00050209 FYVE, RhoGEF and PH domain containing 4 novel protein coding ENST00000582557 670 297 UTR5 Trans
TCONS_00057601 transcribed_unprocessed_pseudogene novel protein coding ENST00000582557 582 292 UTR3 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding ENST00000582557 649 289 UTR5 Trans
TCONS_00065097 UBA domain containing 2 novel protein coding ENST00000582557 649 289 UTR3 Trans
TCONS_00065097 UBA domain containing 2 novel protein coding ENST00000582557 543 239 UTR3 Trans
TCONS_00065103 UBA domain containing 2 novel protein coding ENST00000582557 627 298 UTR5 Trans
TCONS_00065103 UBA domain containing 2 novel protein coding ENST00000582557 649 289 UTR5 Trans
TCONS_00065859 ubiquitin specific peptidase 12 novel protein coding ENST00000582557 722 299 UTR3 Trans
TCONS_00065864 long intergenic non-protein coding RNA 412 novel protein coding ENST00000582557 667 299 UTR3 Trans
TCONS_00085508 neuregulin 4 novel noncoding ENST00000582557 620 306 noncoding Trans
TCONS_00098643 fatty acid 2-hydroxylase novel protein coding ENST00000582557 613 296 UTR5 Trans
TCONS_00098644 fatty acid 2-hydroxylase novel protein coding ENST00000582557 613 296 UTR3 Trans
TCONS_00098645 fatty acid 2-hydroxylase novel protein coding ENST00000582557 613 296 UTR3 Trans
TCONS_00098647 fatty acid 2-hydroxylase novel protein coding ENST00000582557 613 296 UTR3 Trans
TCONS_00105791 arylsulfatase G novel protein coding ENST00000582557 503 307 UTR3 Trans
TCONS_00116668 desmoglein 3 novel protein coding ENST00000582557 624 302 UTR3 Trans
TCONS_00133831 carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein) novel protein coding ENST00000582557 676 308 UTR3 Trans
TCONS_00135631 zinc finger protein 841 novel protein coding ENST00000582557 709 304 UTR3 Trans
TCONS_00147093 ATPase family, AAA domain containing 2B novel protein coding ENST00000582557 605 301 UTR3 Trans
TCONS_00148048 potassium voltage-gated channel, subfamily G, member 3 novel protein coding ENST00000582557 566 301 UTR3 Trans
TCONS_00148387 reticulon 4 novel protein coding ENST00000582557 623 294 UTR3 Trans
TCONS_00148389 reticulon 4 novel protein coding ENST00000582557 623 294 UTR3 Trans
TCONS_00148450 coiled-coil domain containing 88A novel protein coding ENST00000582557 653 302 UTR3 Trans
TCONS_00148450 coiled-coil domain containing 88A novel protein coding ENST00000582557 668 296 UTR3 Trans
TCONS_00157701 VAMP (vesicle-associated membrane protein)-associated protein B and C novel protein coding ENST00000582557 623 299 UTR5 Trans
TCONS_00163891 inducible T-cell co-stimulator ligand novel protein coding ENST00000582557 631 301 UTR3 Trans
TCONS_00165715 LIM domain kinase 2 novel protein coding ENST00000582557 580 291 UTR3 Trans
TCONS_00165721 LIM domain kinase 2 novel protein coding ENST00000582557 580 291 UTR3 Trans
TCONS_00175724 TSC22 domain family, member 2 novel protein coding ENST00000582557 640 299 UTR3 Trans
TCONS_00182613 processed_transcript novel protein coding ENST00000582557 631 297 UTR5 Trans
TCONS_00182614 processed_transcript novel protein coding ENST00000582557 631 297 UTR5 Trans
TCONS_00187165 NEDD4 binding protein 2 novel protein coding ENST00000582557 636 294 UTR3 Trans
TCONS_00189321 transcribed_unprocessed_pseudogene novel protein coding ENST00000582557 639 296 UTR5 Trans
TCONS_00189329 transcribed_unprocessed_pseudogene novel protein coding ENST00000582557 639 296 UTR5 Trans
TCONS_00189333 transcribed_unprocessed_pseudogene novel protein coding ENST00000582557 639 296 UTR5 Trans
TCONS_00189336 transcribed_unprocessed_pseudogene novel protein coding ENST00000582557 639 296 UTR5 Trans
TCONS_00189341 transcribed_unprocessed_pseudogene novel protein coding ENST00000582557 639 296 UTR5 Trans
TCONS_00190999 zinc finger protein 721 novel protein coding ENST00000582557 636 285 UTR5 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000582557 670 302 UTR3 Trans
TCONS_00194686 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000582557 687 301 UTR3 Trans
TCONS_00194686 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000582557 618 291 UTR5 Trans
TCONS_00199319 sorting nexin 24 novel noncoding ENST00000582557 605 294 noncoding Trans
TCONS_00240832 ArfGAP with SH3 domain, ankyrin repeat and PH domain 1 novel protein coding ENST00000582557 665 287 UTR3 Trans
TCONS_00243477 osteoclast stimulating factor 1 novel protein coding ENST00000582557 604 300 UTR5 Trans
TCONS_00243482 osteoclast stimulating factor 1 novel protein coding ENST00000582557 604 300 UTR5 Trans
TCONS_00252827 discs, large homolog 3 (Drosophila) novel protein coding ENST00000582557 617 302 UTR5 Trans

Sequence

>TCONS_00252827 (1559 nt)
ATCTGTATTAGGATGTCATCATATCTGTATTAGGATGTATTAGGATTCTGTTTTGGCTGACTACAATTTTTTTTTTTTTTTTGAGACGGAGTTTTGCTCT
TTGTTGCCCAGGCTGCAGTGCAATGACGCGATCTCGGCTCACGGCAACCTCCGCCTCCCAGGTTCAAGTGATTCTCCTGCCTCAGCCTCCCAGGTAGCTG
GGATTACAGGCATGCGCCACTATGCCTGGCTATTTTTGTATTTTTAGTGGAGGCAGGGTATCTCCATGTTGGTCAGGCCGGTCTCGAACTCCCGACCTCA
GGTGATCTGCCCACCTCAGCCTCCCAAAGTGCTGGGAATACAGGCGTGAGCCACCGCGCCTGGCCGGCTGACTACAAATTTTTTAAGTGACCATTTAAAA
AGTGAAATTTTCATCTTGTTTGGCATCAATCAATAGTTCTTTTGTTGACTCCAGCTACCTATTACAGCTGCTTTTTGGAAGAAAATCGGTTATAAATAGT
TTAAATTAAGCTAAGTTAAATGAGTACAACTGCTTCTCTTGAGTTCTGCTCGGTAACAATAACTATCTTAGAAAGGCTTAAGAAAAATATTGTAAAGAAC
CTTCAGTATAAAAAGCGTAGATGAACTTTGTGAATGTATGCCATTGATTGAATACCTTTTGATCTTACTGTGCATACTAACTTTCTTGATGTAAATATTT
AGTGCGATATAAATATTTAGTGCGTGATTTCCATAGCAGATGACAAGTTTATATTGATTATAACATGGTCTCGGTTGATATTTTTCTGACAAGTAAGTTT
AGATCATGTTTGGATTTTGTTTCCTATTACCTAGAGCCAACACAGATCTATAGATTTCTTTGAACTCGGAATCTCATAGCACCAATATTTTTGCACAGAA
CTCTTACTTACATGTCTCATCGAAACTCCAGAACAAACATCAAAAGGAAAACATTTAAAGTTGATGATATGTTATCAAAAGTAGAGAAAATGAAAGGAGA
GCAAGAATCTCATAGCTTGTCAGCTCATTTGCAGCTTACATTTTTGGTTTCTTCCACAAAAATGATAAGCCATCACCAAACTCAGAAAATGAACAAAATT
CTGTTACCCTGGAAGTCCTGCTTGTGAAAGTTTGCCACAAAAAAAGAAAGGATGTATGTTGTCCAATAAGGCAAGTTCCCACAGGTAAAAAGCAGGTGCC
TTTGAATCCTGACCTCAATCAAACAAAACCTGGAAATTTCCCGTCCCTTGCAGTTTCCAGTAATGAATTTGAACCTAGTAACAGCCACATGGTGAAGTCT
TACTCGTTGCTATTTAGAGTGACTCGTCCAAGAAGAAGAGAGTTTAATGGAATGATTAATGGAGAAACCATGAAAATATTGATGTCAGTGAAGAGCTTCC
AGCCAGAAGAAAATGAAATCGTGAGGATGGGGAAAAGACATTTGTTGCACAAATGACAGTATTTGATAAAAACAGGTAATGTTGATGAACAAGCGAGGCT
CCCACAATGTTCTGGAAATGTTTTCATTCTGAAGCAGAATATAATTATTTATATTGATTA

Expression



Full and truncated open reading frames discovered in TCONS_00252827

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.