| Potential function | Interacting transcript | Gene description | Transcript biotype | lncRNA id | Alignment score (LAST) | Alignment length | Transcript region involved in interaction | Genomic orientation of interacting RNAs |
|---|---|---|---|---|---|---|---|---|
| ENST00000367590 | xenotropic and polytropic retrovirus receptor 1 | protein coding | ENST00000586658 | 581 | 250 | UTR3 | Trans | |
| ENST00000439138 | transmembrane protein 98 | protein coding | ENST00000586658 | 547 | 283 | UTR5 | Trans | |
| ENST00000448214 | antisense | antisense | ENST00000586658 | 547 | 279 | noncoding | Trans | |
| ENST00000482603 | glyoxylate reductase/hydroxypyruvate reductase | processed transcript | ENST00000586658 | 651 | 279 | noncoding | Trans | |
| ENST00000560870 | sense_intronic | sense intronic | ENST00000586658 | 548 | 268 | noncoding | Trans | |
| ENST00000620139 | melanoregulin | protein coding | ENST00000586658 | 670 | 281 | UTR3 | Trans | |
| TCONS_00009095 | xenotropic and polytropic retrovirus receptor 1 | novel protein coding | ENST00000586658 | 581 | 250 | UTR3 | Trans | |
| TCONS_00020768 | processed_transcript | novel protein coding | ENST00000586658 | 630 | 288 | UTR5 | Trans | |
| TCONS_00030165 | antisense | novel protein coding | ENST00000586658 | 547 | 279 | UTR5 | Trans | |
| TCONS_00053503 | anoctamin 4 | novel protein coding | ENST00000586658 | 614 | 281 | UTR3 | Trans | |
| TCONS_00053513 | anoctamin 4 | novel protein coding | ENST00000586658 | 614 | 281 | UTR5 | Trans | |
| TCONS_00065864 | long intergenic non-protein coding RNA 412 | novel protein coding | ENST00000586658 | 719 | 402 | UTR3 | Trans | |
| TCONS_00075844 | forkhead box N3 | novel protein coding | ENST00000586658 | 548 | 279 | UTR3 | Trans | |
| TCONS_00075845 | forkhead box N3 | novel protein coding | ENST00000586658 | 548 | 279 | UTR3 | Trans | |
| TCONS_00101169 | myosin phosphatase Rho interacting protein | novel protein coding | ENST00000586658 | 571 | 281 | UTR3 | Trans | |
| TCONS_00124891 | zinc finger protein 540 | novel protein coding | ENST00000586658 | 746 | 390 | UTR5 | Trans | |
| TCONS_00124891 | zinc finger protein 540 | novel protein coding | ENST00000586658 | 621 | 263 | UTR5 | Trans | |
| TCONS_00185516 | transcribed_unprocessed_pseudogene | novel protein coding | ENST00000586658 | 608 | 276 | UTR5 | Trans | |
| TCONS_00185519 | transcribed_unprocessed_pseudogene | novel protein coding | ENST00000586658 | 608 | 276 | UTR3 | Trans | |
| TCONS_00200504 | Rho GTPase activating protein 26 | novel protein coding | ENST00000586658 | 617 | 279 | UTR3 | Trans | |
| TCONS_00216910 | high mobility group nucleosomal binding domain 3 | novel noncoding | ENST00000586658 | 604 | 283 | noncoding | Trans | |
| TCONS_00226753 | cell division cycle associated 7-like | novel protein coding | ENST00000586658 | 612 | 279 | UTR3 | Trans | |
| TCONS_00240685 | metastasis suppressor 1 | novel protein coding | ENST00000586658 | 529 | 233 | UTR3 | Trans | |
| TCONS_00240688 | metastasis suppressor 1 | novel protein coding | ENST00000586658 | 600 | 279 | UTR3 | Trans | |
| TCONS_00247058 | UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 | novel protein coding | ENST00000586658 | 611 | 279 | UTR3 | Trans |
>TCONS_00247058 (486 nt)
CCCTTCATTTGCCTGCTGGACCCTCCGCCTCAAGGGTAGGGGAAGTGCGCGGTGAGCGGCCTGGGTCTTGCAGGCTCGGCTGGGGCCCGCAGACGGAGTC
TCACTCTGTTGCCCAAGCTGGAGTGCAGTGGCATGATCTCAGCTCACTGCAGCCTCTGCTTTCCGGGTTCAAGCGATTCTCTTGCCTCAGCCTCCTGAGT
AGCTGGGATTACAGGTGGGTGCCACCATGCCTGGCTAATTTTTGTGTTTTTAGTAGAGACGGGGTTTCACCATATTGGTGAGGCTGGTCTTGAACTCTTG
ACCTCGTGATCACCTGCCTTGGCCTCCCAAAGTGGTGGGATTACAGGCATGAGCCACTACGCCTGGCCATCTTAATAATTTTTTTTTTGAGATGAGTTTT
GATCTTGTTGCCCAGGCTGAAGTGCAATGGTGCGATCTTGGCTCACTGCAACCTCTGCCTCCCAGGTTCAAGTGATCTCCTGCCTCA
In silico ORF/peptide predictions
Nothing found.
RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.