Detailed information on ENST00000587380

lncRNA-RNA interactions

Number of interactions: 106

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000310045 dermatan sulfate epimerase-like protein coding ENST00000587380 611 297 UTR3 Trans
ENST00000336824 fibronectin type III domain containing 3B protein coding ENST00000587380 601 296 UTR3 Trans
ENST00000418314 mannosyl (beta-1,4-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase protein coding ENST00000587380 540 297 CDS Trans
ENST00000423516 transketolase protein coding ENST00000587380 600 312 CDS Trans
ENST00000448612 WD repeat domain 27 protein coding ENST00000587380 617 303 CDS Trans
ENST00000470361 potassium large conductance calcium-activated channel, subfamily M, beta member 2 processed transcript ENST00000587380 514 301 noncoding Trans
ENST00000472528 transketolase nonsense mediated decay ENST00000587380 600 312 UTR3 Trans
ENST00000473091 UBA domain containing 2 processed transcript ENST00000587380 592 300 noncoding Trans
ENST00000494969 colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) protein coding ENST00000587380 664 296 CDS Trans
ENST00000524264 SAP30L antisense RNA 1 (head to head) antisense ENST00000587380 571 300 noncoding Trans
ENST00000556539 signal transducer and activator of transcription 2, 113kDa processed transcript ENST00000587380 629 313 noncoding Trans
ENST00000572705 transient receptor potential cation channel, subfamily V, member 1 protein coding ENST00000587380 648 300 UTR3 Trans
ENST00000579685 adenomatosis polyposis coli down-regulated 1 nonsense mediated decay ENST00000587380 515 290 CDS Trans
ENST00000588483 tropomyosin 4 protein coding ENST00000587380 527 303 UTR5 Trans
ENST00000604000 Lix1 homolog (chicken) like protein coding ENST00000587380 625 305 UTR3 Trans
ENST00000607772 CNKSR family member 3 protein coding ENST00000587380 601 296 UTR3 Trans
ENST00000620139 melanoregulin protein coding ENST00000587380 593 305 UTR3 Trans
TCONS_00027001 programmed cell death 4 (neoplastic transformation inhibitor) novel protein coding ENST00000587380 625 302 UTR3 Trans
TCONS_00027009 programmed cell death 4 (neoplastic transformation inhibitor) novel protein coding ENST00000587380 625 302 UTR3 Trans
TCONS_00032153 long intergenic non-protein coding RNA 959 novel noncoding ENST00000587380 612 304 noncoding Trans
TCONS_00034643 CD82 molecule novel protein coding ENST00000587380 628 294 UTR3 Trans
TCONS_00046540 sestrin 3 novel protein coding ENST00000587380 611 303 UTR5 Trans
TCONS_00058750 lincRNA novel protein coding ENST00000587380 606 301 UTR3 Trans
TCONS_00059486 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000587380 629 313 UTR3 Trans
TCONS_00059487 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000587380 629 313 UTR3 Trans
TCONS_00059488 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000587380 629 313 UTR3 Trans
TCONS_00059489 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000587380 629 313 UTR3 Trans
TCONS_00059491 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000587380 629 313 UTR3 Trans
TCONS_00059493 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000587380 629 313 UTR3 Trans
TCONS_00059495 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000587380 629 313 UTR3 Trans
TCONS_00059497 signal transducer and activator of transcription 2, 113kDa novel protein coding ENST00000587380 629 313 UTR3 Trans
TCONS_00065093 UBA domain containing 2 novel protein coding ENST00000587380 672 300 UTR5 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding ENST00000587380 614 322 UTR5 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding ENST00000587380 672 300 UTR5 Trans
TCONS_00065097 UBA domain containing 2 novel protein coding ENST00000587380 614 322 UTR3 Trans
TCONS_00065103 UBA domain containing 2 novel protein coding ENST00000587380 614 322 UTR5 Trans
TCONS_00065103 UBA domain containing 2 novel protein coding ENST00000587380 672 300 UTR5 Trans
TCONS_00070307 pecanex homolog (Drosophila) novel protein coding ENST00000587380 671 295 UTR5 Trans
TCONS_00083866 RAB27A, member RAS oncogene family novel protein coding ENST00000587380 603 302 UTR5 Trans
TCONS_00089066 eukaryotic elongation factor-2 kinase novel protein coding ENST00000587380 608 311 UTR3 Trans
TCONS_00090929 nucleoporin 93kDa novel protein coding ENST00000587380 629 279 UTR3 Trans
TCONS_00103261 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000587380 609 324 UTR5 Trans
TCONS_00103261 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000587380 613 300 UTR5 Trans
TCONS_00103262 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000587380 609 324 UTR5 Trans
TCONS_00103262 Rap guanine nucleotide exchange factor (GEF)-like 1 novel protein coding ENST00000587380 613 300 UTR5 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000587380 648 300 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000587380 643 285 UTR5 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000587380 643 285 UTR3 Trans
TCONS_00109427 serine hydroxymethyltransferase 1 (soluble) novel protein coding ENST00000587380 679 298 UTR3 Trans
TCONS_00118358 l(3)mbt-like 4 (Drosophila) novel protein coding ENST00000587380 607 284 UTR3 Trans
TCONS_00118361 l(3)mbt-like 4 (Drosophila) novel protein coding ENST00000587380 607 284 UTR3 Trans
TCONS_00119512 zinc finger and BTB domain containing 7C novel protein coding ENST00000587380 614 291 UTR3 Trans
TCONS_00119961 ring finger protein 152 novel protein coding ENST00000587380 626 299 UTR5 Trans
TCONS_00123889 ribosomal protein SA pseudogene 58 novel protein coding ENST00000587380 606 287 UTR5 Trans
TCONS_00123899 ribosomal protein SA pseudogene 58 novel protein coding ENST00000587380 606 287 UTR5 Trans
TCONS_00124891 zinc finger protein 540 novel protein coding ENST00000587380 719 291 UTR3 Trans
TCONS_00124891 zinc finger protein 540 novel protein coding ENST00000587380 632 301 UTR5 Trans
TCONS_00132247 zinc finger protein 43 novel noncoding ENST00000587380 612 302 noncoding Trans
TCONS_00140000 long intergenic non-protein coding RNA 152 novel protein coding ENST00000587380 588 298 UTR3 Trans
TCONS_00141404 GLI family zinc finger 2 novel protein coding ENST00000587380 616 277 UTR5 Trans
TCONS_00147093 ATPase family, AAA domain containing 2B novel protein coding ENST00000587380 651 298 UTR3 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding ENST00000587380 601 299 UTR3 Trans
TCONS_00147113 ATPase family, AAA domain containing 2B novel protein coding ENST00000587380 601 299 UTR3 Trans
TCONS_00147115 ATPase family, AAA domain containing 2B novel protein coding ENST00000587380 601 299 UTR3 Trans
TCONS_00148387 reticulon 4 novel protein coding ENST00000587380 628 301 UTR3 Trans
TCONS_00148389 reticulon 4 novel protein coding ENST00000587380 628 301 UTR3 Trans
TCONS_00161618 interferon gamma receptor 2 (interferon gamma transducer 1) novel protein coding ENST00000587380 628 295 UTR3 Trans
TCONS_00168219 THO complex 5 novel protein coding ENST00000587380 613 272 UTR3 Trans
TCONS_00168220 THO complex 5 novel protein coding ENST00000587380 613 272 UTR3 Trans
TCONS_00180671 transketolase novel protein coding ENST00000587380 600 312 UTR5 Trans
TCONS_00180672 transketolase novel protein coding ENST00000587380 600 312 UTR5 Trans
TCONS_00180673 transketolase novel protein coding ENST00000587380 600 312 UTR5 Trans
TCONS_00185321 transferrin receptor novel protein coding ENST00000587380 684 299 UTR5 Trans
TCONS_00185516 transcribed_unprocessed_pseudogene novel protein coding ENST00000587380 621 299 UTR3 Trans
TCONS_00185519 transcribed_unprocessed_pseudogene novel protein coding ENST00000587380 621 299 UTR3 Trans
TCONS_00186316 KIAA0232 novel protein coding ENST00000587380 639 299 UTR5 Trans
TCONS_00187460 spermatogenesis associated 18 novel protein coding ENST00000587380 610 298 UTR3 Trans
TCONS_00187473 spermatogenesis associated 18 novel noncoding ENST00000587380 615 298 noncoding Trans
TCONS_00190276 transmembrane protein 144 novel protein coding ENST00000587380 657 286 UTR3 Trans
TCONS_00194652 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000587380 619 298 UTR5 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000587380 619 298 UTR5 Trans
TCONS_00202516 family with sequence similarity 173, member B novel protein coding ENST00000587380 608 292 UTR5 Trans
TCONS_00202828 myotubularin related protein 12 novel protein coding ENST00000587380 668 297 UTR3 Trans
TCONS_00203984 family with sequence similarity 169, member A novel protein coding ENST00000587380 606 314 UTR5 Trans
TCONS_00203985 family with sequence similarity 169, member A novel protein coding ENST00000587380 606 314 UTR5 Trans
TCONS_00203988 family with sequence similarity 169, member A novel noncoding ENST00000587380 606 314 noncoding Trans
TCONS_00212185 TEC novel protein coding ENST00000587380 599 297 UTR3 Trans
TCONS_00213191 tubby like protein 4 novel protein coding ENST00000587380 645 292 UTR5 Trans
TCONS_00219475 WD repeat domain 27 novel protein coding ENST00000587380 617 303 UTR3 Trans
TCONS_00221037 POU class 6 homeobox 2 novel noncoding ENST00000587380 639 307 noncoding Trans
TCONS_00222612 carnitine O-octanoyltransferase novel protein coding ENST00000587380 667 306 UTR3 Trans
TCONS_00222619 carnitine O-octanoyltransferase novel protein coding ENST00000587380 667 306 UTR3 Trans
TCONS_00222623 carnitine O-octanoyltransferase novel protein coding ENST00000587380 667 306 UTR3 Trans
TCONS_00224726 caldesmon 1 novel protein coding ENST00000587380 523 289 UTR3 Trans
TCONS_00224728 caldesmon 1 novel protein coding ENST00000587380 523 289 UTR3 Trans
TCONS_00234854 zinc finger and BTB domain containing 10 novel protein coding ENST00000587380 639 273 UTR3 Trans
TCONS_00235281 NADH dehydrogenase (ubiquinone) complex I, assembly factor 6 novel protein coding ENST00000587380 600 317 UTR5 Trans
TCONS_00239255 tumor protein D52 novel protein coding ENST00000587380 646 301 UTR5 Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000587380 603 301 UTR3 Trans
TCONS_00244033 WNK lysine deficient protein kinase 2 novel protein coding ENST00000587380 603 299 UTR5 Trans
TCONS_00244038 WNK lysine deficient protein kinase 2 novel protein coding ENST00000587380 603 299 UTR5 Trans
TCONS_00244055 WNK lysine deficient protein kinase 2 novel protein coding ENST00000587380 603 299 UTR3 Trans
TCONS_00244067 WNK lysine deficient protein kinase 2 novel protein coding ENST00000587380 603 299 UTR5 Trans
TCONS_00245543 long intergenic non-protein coding RNA 963 novel protein coding ENST00000587380 635 286 UTR3 Trans
TCONS_00249092 transmembrane protein 245 novel protein coding ENST00000587380 637 283 UTR5 Trans
TCONS_00252827 discs, large homolog 3 (Drosophila) novel protein coding ENST00000587380 661 296 UTR5 Trans

Sequence

>TCONS_00252827 (1955 nt)
TGTAAATTAAACATGACAACATGCATTATTCCTGTAGTTCAAATAGTGACAGAAAAAAATTAATTAAAAAAAGAAAAAAGACTGGGCGTGGTGGCTCACA
CCTGTAATCCCAGCACTTTGGGAGGCCAAGGCGGGTGGATTACCTGAGGTCAGGAGTTCGAAACCAGCCTGACTAATACGGTGAAACCCCATCTACTAAA
AATACAAAAATTAGCCAGGTGGGGTGATGCTGTAATCCCAGCTAGTCAGGAGGCTGAGGCAGAGGTTGTGGTGAGGGGAGATCATGCCATTGCACTCCAG
CCTGGGCAACAAGAGCAAAACTCCGTCTCAAAAAAAAAAAAATCAATTAAAAAAAGAAAAAAATGCATTCTTATCAGACTTTTATGTTTCTCATATATAG
CACTGTTTTCGACAGACTTAAACATAGTTATTTATTATATACCACTTTTTTGCACAAATCAAAAGGAAAATTGGCTGGGTGCAGTGGCTCACACTTGTAA
TCCCATCATTTTGGGAGGCTGAGGTGGGCGGATCACGAGGTCAGGAGTTTGAGACCAGCCTGGCCAACATGGTGAAACCCCATCTCTACTAAAAATAGAA
AAAATAGCTGGGCGTAGTGGTGGGCACCTGTAATCCCAGCTACTCGGGAGTCTGAGGCAGGAGAGTCGCTTGAACCCGGGAGGCGGAGGTTGCAGTGAGC
CAAGGTCACACCATTGCACTCCAGCCTGGGCGACATGGTGAGACTCCATTTCAAAAAAAAAAAAGGAAAATAAGTGAAATAAACAAAAAAATCAGTTTAA
CTTTTTGCCATATCAGACATCCTTAGAAGAATAAACATTGGCCGGGCGCGGTGGCTTATGCCTATAATCCCAGCACTTTGGGAGGCTAAAGCAGGCTGAT
CACCTGAGGTCGGGAGTTTGAGACCAGCCTGACCAACATGGAGAAACCCCATCTCTACTAAAAATAGAAAAAAAAAATTAGCCAGGCATGGCGGTGCATG
CCTGTAGCCCCACCGACTTGGAGGCTGAGGCAGGAGAATCACTTGAATCCGGTAGGCGGAGGTTGCGGTGAGCCGAGATCGTGCCATTGCACTCCAACCT
GGGCGACAAGAGTGAAACTCTGTCTCAAAAAAAAGAATAAACATTAGGCTCTGTTAGTATGAAAAAGCCTTGTTTATGTATGATTTTTCCAGTGCTGAAA
ATGGGATGGAGATTTAGAAGCTTTGGAGGGAGGTGGTTTTATGTTTTTCATGTGTCCTGGATTCCTCTTGTGTGGCCATAGCAGAGGGCAGTGATAGGGG
CATCCCTTACAAATGCCCTTTTACTGTCTGGCTTGGTTAGAGTTCTTTGGCCAAGTTCCTGCCTCTGTTGTTATGGTCCTCCTACCAGTTCATTTAGGGA
TCAAGAGTTAATGAGTCTCTCGGGTCGTTTTTGTGAGGTCCAGCTTTGTAAGGAGTCCTTCCTTCCTTACGTCTTGGCTTAAGACATGTCCTGCTGCTGC
TAAGTTGTCACAGTCCCATAGGGGGGCAAAATGAGAGGAGCTTTTAAGACGGACTTCACGATTGCAGCATTTTAAATGGCTACATGTTTTATTTCCTTAG
CTTTAGTGTTTCTGTAGAGAAAAGAGATGGATTTCAATTTTTTTGCATGTCACTCTGACAAAGTTCTGTTTCCCTTACAGCAGCCAAGAAACTAAAATAA
GGCTAGGCTTAGTGGCTCATGCCTGTAATCTTAGCACTTTGTGAGGCCAAAATGAGAGGATCGCTTAAGCCCAGTAGTTTGAGACCAGCCTGGGCAACAT
AGTGAGACTTAGTCTCTATAAAAACATTTAAGGCTGGGTGCGGTGGCTCACGCCTGTAATTCCAGCACCTTGGGAGGCTGAGGCCAGTGGATTGCTTGAG
GCCAGGAGTTCGAGACCAACCTGGGCAACGTGGTGAAACCCGCCCCCCATCTCTGT

Expression



Full and truncated open reading frames discovered in TCONS_00252827

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.