| Potential function | Interacting transcript | Gene description | Transcript biotype | lncRNA id | Alignment score (LAST) | Alignment length | Transcript region involved in interaction | Genomic orientation of interacting RNAs |
|---|---|---|---|---|---|---|---|---|
| ENST00000075120 | solute carrier family 2 (facilitated glucose transporter), member 3 | protein coding | ENST00000588137 | 504 | 293 | UTR3 | Trans | |
| ENST00000323816 | growth arrest-specific 7 | protein coding | ENST00000588137 | 577 | 289 | UTR3 | Trans | |
| ENST00000367590 | xenotropic and polytropic retrovirus receptor 1 | protein coding | ENST00000588137 | 529 | 250 | UTR3 | Trans | |
| ENST00000382142 | myotubularin related protein 12 | protein coding | ENST00000588137 | 587 | 288 | UTR3 | Trans | |
| ENST00000437099 | growth arrest-specific 7 | protein coding | ENST00000588137 | 577 | 289 | UTR3 | Trans | |
| ENST00000482603 | glyoxylate reductase/hydroxypyruvate reductase | processed transcript | ENST00000588137 | 636 | 289 | noncoding | Trans | |
| ENST00000498813 | delta(4)-desaturase, sphingolipid 1 | processed transcript | ENST00000588137 | 561 | 298 | noncoding | Trans | |
| ENST00000513143 | podoplanin | protein coding | ENST00000588137 | 523 | 297 | UTR5 | Trans | |
| ENST00000552918 | spermatogenesis associated, serine-rich 2 | protein coding | ENST00000588137 | 612 | 280 | UTR3 | Trans | |
| ENST00000553127 | spermatogenesis associated, serine-rich 2 | protein coding | ENST00000588137 | 640 | 294 | UTR3 | Trans | |
| ENST00000620139 | melanoregulin | protein coding | ENST00000588137 | 654 | 294 | UTR3 | Trans | |
| TCONS_00009095 | xenotropic and polytropic retrovirus receptor 1 | novel protein coding | ENST00000588137 | 529 | 250 | UTR3 | Trans | |
| TCONS_00009834 | SRY (sex determining region Y)-box 13 | novel protein coding | ENST00000588137 | 620 | 295 | UTR3 | Trans | |
| TCONS_00030130 | calcium/calmodulin-dependent protein kinase II gamma | novel protein coding | ENST00000588137 | 618 | 294 | UTR3 | Trans | |
| TCONS_00030591 | cytoplasmic polyadenylation element binding protein 3 | novel protein coding | ENST00000588137 | 634 | 295 | UTR3 | Trans | |
| TCONS_00050195 | FYVE, RhoGEF and PH domain containing 4 | novel protein coding | ENST00000588137 | 612 | 294 | UTR5 | Trans | |
| TCONS_00050741 | spermatogenesis associated, serine-rich 2 | novel protein coding | ENST00000588137 | 640 | 294 | UTR3 | Trans | |
| TCONS_00101169 | myosin phosphatase Rho interacting protein | novel protein coding | ENST00000588137 | 549 | 296 | UTR3 | Trans | |
| TCONS_00117136 | CBP80/20-dependent translation initiation factor | novel protein coding | ENST00000588137 | 511 | 298 | UTR3 | Trans | |
| TCONS_00149970 | cytochrome P450, family 4, subfamily F, polypeptide 32, pseudogene | novel protein coding | ENST00000588137 | 531 | 288 | UTR3 | Trans | |
| TCONS_00149979 | ankyrin repeat domain 20 family, member A8, pseudogene | novel protein coding | ENST00000588137 | 531 | 288 | UTR3 | Trans | |
| TCONS_00190999 | zinc finger protein 721 | novel protein coding | ENST00000588137 | 633 | 293 | UTR3 | Trans | |
| TCONS_00194652 | E74-like factor 2 (ets domain transcription factor) | novel protein coding | ENST00000588137 | 627 | 295 | UTR5 | Trans | |
| TCONS_00194655 | E74-like factor 2 (ets domain transcription factor) | novel protein coding | ENST00000588137 | 627 | 295 | UTR5 | Trans | |
| TCONS_00203985 | family with sequence similarity 169, member A | novel protein coding | ENST00000588137 | 669 | 293 | UTR5 | Trans | |
| TCONS_00213738 | enoyl-CoA delta isomerase 2 | novel protein coding | ENST00000588137 | 501 | 297 | UTR3 | Trans | |
| TCONS_00226753 | cell division cycle associated 7-like | novel protein coding | ENST00000588137 | 631 | 294 | UTR3 | Trans | |
| TCONS_00243136 | glioblastoma down-regulated RNA | novel protein coding | ENST00000588137 | 511 | 285 | UTR3 | Trans | |
| TCONS_00247616 | unprocessed_pseudogene | novel protein coding | ENST00000588137 | 511 | 285 | UTR3 | Trans | |
| TCONS_00247617 | unprocessed_pseudogene | novel protein coding | ENST00000588137 | 511 | 285 | UTR3 | Trans | |
| TCONS_00251977 | G protein-coupled receptor 82 | novel protein coding | ENST00000588137 | 507 | 293 | UTR3 | Trans |
>TCONS_00251977 (476 nt)
TCTTCGCCAGCACGCTGATCACCACCGTGGATACGAGGCTGGCCATGCCATGTGGGAGATGGAGTTATTGCTCAACTCAAATCACTCTCCACCATCCATC
TCTAAAACTTTTTTTTTTTTTTGAGACGGATTCTTGCTCTGTCACCCAGGCTGGAATGCAGTAGCACAATCTTGGCTCACTGCAACCTCCACCTCCCAGG
TTCAAGTGATTCTTCTGCCTCAGCCTGCTGAGTAGCTGGGACTATAGGCGTGAGCCACCATGCCCGGCTAATTTTTGCATTTTTAGTAGAGACGGGGTTT
CACCATATTGGTCAGGCTAGTCTTGAACTCCTGACCTCATAATCTGCCCGCCTAGGCCTCCCAAAGTGCTGGGATTACAGACCTGAGCCACCACGCCTGG
CCCATTGTCTCGCCCATTTTAGAATAGGGCAAGCTGAGGCTCAGAGCCAGGCAAGAGCCTGCACCCTTCATTCTTTG
In silico ORF/peptide predictions
Nothing found.
RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.