Detailed information on ENST00000589086

lncRNA-RNA interactions

Number of interactions: 114

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000262134 lysophosphatidylcholine acyltransferase 2 protein coding ENST00000589086 610 306 UTR3 Trans
ENST00000263955 serine/threonine kinase 17b protein coding ENST00000589086 672 301 UTR3 Trans
ENST00000276431 tumor necrosis factor receptor superfamily, member 10b protein coding ENST00000589086 541 277 UTR3 Trans
ENST00000280800 phospholipase B domain containing 2 protein coding ENST00000589086 607 310 UTR3 Trans
ENST00000301178 AXL receptor tyrosine kinase protein coding ENST00000589086 632 317 UTR3 Trans
ENST00000316077 MAP7 domain containing 3 protein coding ENST00000589086 598 316 UTR3 Trans
ENST00000336505 suppressor of cancer cell invasion protein coding ENST00000589086 624 296 UTR3 Trans
ENST00000357613 transmembrane protein 170A protein coding ENST00000589086 604 307 UTR3 Trans
ENST00000368489 ATPase, aminophospholipid transporter, class I, type 8B, member 2 protein coding ENST00000589086 516 319 UTR3 Trans
ENST00000371065 leptin receptor overlapping transcript protein coding ENST00000589086 561 313 UTR3 Trans
ENST00000375120 OTU deubiquitinase 3 protein coding ENST00000589086 692 301 UTR3 Trans
ENST00000375234 AhpC/TSA antioxidant enzyme domain containing 1 protein coding ENST00000589086 595 300 UTR3 Trans
ENST00000382044 tumor protein p53 binding protein 1 protein coding ENST00000589086 598 309 UTR3 Trans
ENST00000446045 AhpC/TSA antioxidant enzyme domain containing 1 protein coding ENST00000589086 595 300 UTR3 Trans
ENST00000473091 UBA domain containing 2 processed transcript ENST00000589086 550 308 noncoding Trans
ENST00000494969 colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage) protein coding ENST00000589086 609 303 CDS Trans
ENST00000507297 transmembrane protein 173 retained intron ENST00000589086 508 290 noncoding Trans
ENST00000511184 E74-like factor 2 (ets domain transcription factor) nonsense mediated decay ENST00000589086 607 306 CDS_UTR Trans
ENST00000534514 flavin containing monooxygenase 3 processed transcript ENST00000589086 571 318 noncoding Trans
ENST00000549365 DNA-damage regulated autophagy modulator 1 nonsense mediated decay ENST00000589086 578 317 CDS_UTR Trans
ENST00000568559 transmembrane protein 170A nonsense mediated decay ENST00000589086 604 307 UTR3 Trans
ENST00000569540 transmembrane protein 170A protein coding ENST00000589086 604 307 UTR3 Trans
ENST00000607772 CNKSR family member 3 protein coding ENST00000589086 609 288 UTR3 Trans
TCONS_00008112 nicastrin novel protein coding ENST00000589086 553 318 UTR3 Trans
TCONS_00011358 5-methyltetrahydrofolate-homocysteine methyltransferase novel protein coding ENST00000589086 608 288 UTR5 Trans
TCONS_00011359 5-methyltetrahydrofolate-homocysteine methyltransferase novel protein coding ENST00000589086 608 288 UTR5 Trans
TCONS_00014134 collagen, type XVI, alpha 1 novel protein coding ENST00000589086 633 303 UTR3 Trans
TCONS_00025758 zinc finger, MIZ-type containing 1 novel protein coding ENST00000589086 636 313 UTR5 Trans
TCONS_00025760 zinc finger, MIZ-type containing 1 novel protein coding ENST00000589086 636 313 UTR5 Trans
TCONS_00025761 zinc finger, MIZ-type containing 1 novel protein coding ENST00000589086 636 313 UTR5 Trans
TCONS_00027001 programmed cell death 4 (neoplastic transformation inhibitor) novel protein coding ENST00000589086 566 288 UTR3 Trans
TCONS_00027009 programmed cell death 4 (neoplastic transformation inhibitor) novel protein coding ENST00000589086 566 288 UTR3 Trans
TCONS_00030130 calcium/calmodulin-dependent protein kinase II gamma novel protein coding ENST00000589086 717 294 UTR3 Trans
TCONS_00030588 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000589086 689 318 UTR3 Trans
TCONS_00032161 transcription elongation regulator 1-like novel protein coding ENST00000589086 530 316 UTR3 Trans
TCONS_00039782 GRAM domain containing 1B novel protein coding ENST00000589086 637 308 UTR5 Trans
TCONS_00041296 RIC3 acetylcholine receptor chaperone novel protein coding ENST00000589086 671 318 UTR3 Trans
TCONS_00041298 RIC3 acetylcholine receptor chaperone novel protein coding ENST00000589086 671 318 UTR3 Trans
TCONS_00053512 anoctamin 4 novel protein coding ENST00000589086 611 305 UTR3 Trans
TCONS_00065093 UBA domain containing 2 novel protein coding ENST00000589086 627 320 UTR5 Trans
TCONS_00065093 UBA domain containing 2 novel protein coding ENST00000589086 631 317 UTR5 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding ENST00000589086 627 320 UTR5 Trans
TCONS_00065094 UBA domain containing 2 novel protein coding ENST00000589086 631 317 UTR5 Trans
TCONS_00065103 UBA domain containing 2 novel protein coding ENST00000589086 631 317 UTR5 Trans
TCONS_00074894 lincRNA novel protein coding ENST00000589086 608 314 UTR3 Trans
TCONS_00075009 actinin, alpha 1 novel protein coding ENST00000589086 600 289 UTR3 Trans
TCONS_00075339 latent transforming growth factor beta binding protein 2 novel protein coding ENST00000589086 598 311 UTR3 Trans
TCONS_00075813 forkhead box N3 novel protein coding ENST00000589086 669 317 UTR5 Trans
TCONS_00075827 forkhead box N3 novel protein coding ENST00000589086 669 317 UTR3 Trans
TCONS_00083866 RAB27A, member RAS oncogene family novel protein coding ENST00000589086 615 327 UTR5 Trans
TCONS_00090805 lysophosphatidylcholine acyltransferase 2 novel protein coding ENST00000589086 610 306 UTR3 Trans
TCONS_00098644 fatty acid 2-hydroxylase novel protein coding ENST00000589086 614 322 UTR3 Trans
TCONS_00098645 fatty acid 2-hydroxylase novel protein coding ENST00000589086 614 322 UTR3 Trans
TCONS_00098647 fatty acid 2-hydroxylase novel protein coding ENST00000589086 614 322 UTR3 Trans
TCONS_00098745 transmembrane protein 170A novel protein coding ENST00000589086 604 307 UTR3 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000589086 617 311 UTR5 Trans
TCONS_00107851 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000589086 629 318 UTR5 Trans
TCONS_00107864 transient receptor potential cation channel, subfamily V, member 1 novel protein coding ENST00000589086 629 318 UTR3 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000589086 571 302 UTR5 Trans
TCONS_00118361 l(3)mbt-like 4 (Drosophila) novel protein coding ENST00000589086 614 313 UTR5 Trans
TCONS_00118919 potassium channel tetramerization domain containing 1 novel protein coding ENST00000589086 652 303 UTR3 Trans
TCONS_00119478 zinc finger and BTB domain containing 7C novel protein coding ENST00000589086 615 304 UTR5 Trans
TCONS_00119961 ring finger protein 152 novel protein coding ENST00000589086 617 304 UTR5 Trans
TCONS_00125532 AXL receptor tyrosine kinase novel protein coding ENST00000589086 632 317 UTR3 Trans
TCONS_00135884 zinc finger protein 347 novel protein coding ENST00000589086 620 313 UTR5 Trans
TCONS_00140000 long intergenic non-protein coding RNA 152 novel protein coding ENST00000589086 622 296 UTR3 Trans
TCONS_00141404 GLI family zinc finger 2 novel protein coding ENST00000589086 642 280 UTR5 Trans
TCONS_00145814 melanophilin novel protein coding ENST00000589086 630 314 UTR3 Trans
TCONS_00147100 ATPase family, AAA domain containing 2B novel protein coding ENST00000589086 651 289 UTR3 Trans
TCONS_00148698 WD repeat containing planar cell polarity effector novel noncoding ENST00000589086 605 286 noncoding Trans
TCONS_00148704 WD repeat containing planar cell polarity effector novel protein coding ENST00000589086 605 286 UTR3 Trans
TCONS_00148705 WD repeat containing planar cell polarity effector novel protein coding ENST00000589086 605 286 UTR3 Trans
TCONS_00153158 serine/threonine kinase 17b novel protein coding ENST00000589086 672 301 UTR3 Trans
TCONS_00161618 interferon gamma receptor 2 (interferon gamma transducer 1) novel protein coding ENST00000589086 600 297 UTR3 Trans
TCONS_00163084 T-cell lymphoma invasion and metastasis 1 novel protein coding ENST00000589086 617 297 UTR5 Trans
TCONS_00163367 runt-related transcription factor 1 novel protein coding ENST00000589086 612 314 UTR3 Trans
TCONS_00171146 F-box and leucine-rich repeat protein 2 novel noncoding ENST00000589086 621 266 noncoding Trans
TCONS_00186316 KIAA0232 novel protein coding ENST00000589086 638 306 UTR3 Trans
TCONS_00189916 doublecortin-like kinase 2 novel protein coding ENST00000589086 639 299 UTR3 Trans
TCONS_00189917 doublecortin-like kinase 2 novel protein coding ENST00000589086 639 299 UTR3 Trans
TCONS_00189925 doublecortin-like kinase 2 novel protein coding ENST00000589086 639 299 UTR3 Trans
TCONS_00194682 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000589086 607 306 UTR3 Trans
TCONS_00194686 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000589086 607 306 UTR3 Trans
TCONS_00202516 family with sequence similarity 173, member B novel protein coding ENST00000589086 644 291 UTR5 Trans
TCONS_00202828 myotubularin related protein 12 novel protein coding ENST00000589086 636 300 UTR3 Trans
TCONS_00202828 myotubularin related protein 12 novel protein coding ENST00000589086 637 308 UTR3 Trans
TCONS_00203984 family with sequence similarity 169, member A novel protein coding ENST00000589086 617 315 UTR5 Trans
TCONS_00203984 family with sequence similarity 169, member A novel protein coding ENST00000589086 621 276 UTR5 Trans
TCONS_00203985 family with sequence similarity 169, member A novel protein coding ENST00000589086 617 315 UTR5 Trans
TCONS_00203985 family with sequence similarity 169, member A novel protein coding ENST00000589086 621 276 UTR5 Trans
TCONS_00203988 family with sequence similarity 169, member A novel noncoding ENST00000589086 617 315 noncoding Trans
TCONS_00205177 peptidylprolyl isomerase C (cyclophilin C) novel protein coding ENST00000589086 619 316 UTR3 Trans
TCONS_00213191 tubby like protein 4 novel protein coding ENST00000589086 630 283 UTR5 Trans
TCONS_00215909 O-acyl-ADP-ribose deacylase 1 novel protein coding ENST00000589086 643 306 UTR3 Trans
TCONS_00221037 POU class 6 homeobox 2 novel noncoding ENST00000589086 654 306 noncoding Trans
TCONS_00224726 caldesmon 1 novel protein coding ENST00000589086 540 291 UTR3 Trans
TCONS_00224728 caldesmon 1 novel protein coding ENST00000589086 540 291 UTR3 Trans
TCONS_00233179 BCL2/adenovirus E1B 19kDa interacting protein 3-like novel protein coding ENST00000589086 633 300 UTR3 Trans
TCONS_00233718 pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 2 novel protein coding ENST00000589086 604 292 UTR5 Trans
TCONS_00234854 zinc finger and BTB domain containing 10 novel protein coding ENST00000589086 602 276 UTR3 Trans
TCONS_00235281 NADH dehydrogenase (ubiquinone) complex I, assembly factor 6 novel protein coding ENST00000589086 622 316 UTR5 Trans
TCONS_00235393 processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae) novel protein coding ENST00000589086 679 310 UTR5 Trans
TCONS_00239255 tumor protein D52 novel protein coding ENST00000589086 610 315 UTR5 Trans
TCONS_00240045 zinc finger protein 706 novel protein coding ENST00000589086 534 299 UTR3 Trans
TCONS_00240046 zinc finger protein 706 novel protein coding ENST00000589086 534 299 UTR3 Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000589086 668 302 CDS_UTR Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000589086 617 307 UTR3 Trans
TCONS_00244033 WNK lysine deficient protein kinase 2 novel protein coding ENST00000589086 629 289 UTR5 Trans
TCONS_00244038 WNK lysine deficient protein kinase 2 novel protein coding ENST00000589086 629 289 UTR5 Trans
TCONS_00244055 WNK lysine deficient protein kinase 2 novel protein coding ENST00000589086 629 289 UTR3 Trans
TCONS_00244067 WNK lysine deficient protein kinase 2 novel protein coding ENST00000589086 629 289 UTR5 Trans
TCONS_00249683 suppressor of cancer cell invasion novel protein coding ENST00000589086 624 296 UTR3 Trans
TCONS_00253055 uracil phosphoribosyltransferase (FUR1) homolog (S. cerevisiae) novel protein coding ENST00000589086 606 311 UTR3 Trans
TCONS_00253258 sushi-repeat containing protein, X-linked 2 novel protein coding ENST00000589086 657 310 UTR3 Trans

Sequence

>TCONS_00253258 (548 nt)
AAGAAAGGATATTGGGGCTGGGTGCAGTGGCTCACGCCTGTAATTCCAGCACTTTGGGAGGCTGAGGCGGGCGGATCACTTAAGGTCAGGAATTCAAGAC
CAGCCTGGCCAACATAGTGAAACTCCGTCCCTACTAGAAATACAAAAATTAGCCAGGCATGGTGGCGCATGCCTGTAATCCCAGCTACTCAAGAGGCTGA
GACAGGAGAATCTCTTGAACCCGGGAGGTGGAGGTTGCAGTGAGCTGAGATTGCACCACTGCACTCCAGCCTGGGCAACAGAGTAAGACTCTGCCTCAAA
AAACAAAAAAAAAAAAAGAAAGAGAAAGAGGATATTGGAATAAACGCTAATATGCACCTTTGGGAGCTGCTTTTTGAAATATTGGTTCTTGAAATTCGAA
ATGAGTCCCATGACTATCCTCATAGAGTGGCCAAGTTTCCAGAAAACAGAAATCGAAACAGATACAGAGATGTAAGCCCATATGATCACAGTCGTGTTAA
ACTGCAAAATGCTGAGAATGATTATATTAATGCCAGTTTAGTTGACATA

Expression



Full and truncated open reading frames discovered in TCONS_00253258

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.