Detailed information on ENST00000589372

lncRNA-RNA interactions

Number of interactions: 62

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000182527 translocation associated membrane protein 2 protein coding ENST00000589372 532 296 UTR3 Trans
ENST00000257287 centrosomal protein 135kDa protein coding ENST00000589372 607 300 UTR3 Trans
ENST00000355285 adenomatosis polyposis coli down-regulated 1 protein coding ENST00000589372 539 302 UTR3 Trans
ENST00000378004 Rho GTPase activating protein 26 protein coding ENST00000589372 566 301 UTR3 Trans
ENST00000409359 Rho guanine nucleotide exchange factor (GEF) 4 protein coding ENST00000589372 522 284 UTR3 Trans
ENST00000439138 transmembrane protein 98 protein coding ENST00000589372 583 292 UTR5 Trans
ENST00000463899 N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase) processed transcript ENST00000589372 521 291 noncoding Trans
ENST00000478730 ORAI calcium release-activated calcium modulator 2 protein coding ENST00000589372 507 404 UTR3 Trans
ENST00000478730 ORAI calcium release-activated calcium modulator 2 protein coding ENST00000589372 615 268 UTR3 Trans
ENST00000498813 delta(4)-desaturase, sphingolipid 1 processed transcript ENST00000589372 630 303 noncoding Trans
ENST00000506202 centrosomal protein 135kDa retained intron ENST00000589372 607 300 noncoding Trans
ENST00000513143 podoplanin protein coding ENST00000589372 621 304 UTR5 Trans
TCONS_00008758 flavin containing monooxygenase 4 novel protein coding ENST00000589372 559 300 UTR3 Trans
TCONS_00010841 epoxide hydrolase 1, microsomal (xenobiotic) novel protein coding ENST00000589372 583 298 UTR3 Trans
TCONS_00017068 calponin 3, acidic novel protein coding ENST00000589372 566 305 UTR3 Trans
TCONS_00030588 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000589372 941 587 UTR3 Trans
TCONS_00030591 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000589372 992 587 UTR3 Trans
TCONS_00033132 dynein heavy chain domain 1 novel protein coding ENST00000589372 628 281 UTR3 Trans
TCONS_00043422 vacuolar protein sorting 37 homolog C (S. cerevisiae) novel protein coding ENST00000589372 720 580 UTR5 Trans
TCONS_00056991 epidermal growth factor receptor pathway substrate 8 novel protein coding ENST00000589372 534 287 UTR3 Trans
TCONS_00065864 long intergenic non-protein coding RNA 412 novel protein coding ENST00000589372 630 295 UTR3 Trans
TCONS_00089065 eukaryotic elongation factor-2 kinase novel protein coding ENST00000589372 616 280 UTR3 Trans
TCONS_00089066 eukaryotic elongation factor-2 kinase novel protein coding ENST00000589372 616 280 UTR3 Trans
TCONS_00095053 epithelial membrane protein 2 novel protein coding ENST00000589372 589 375 UTR3 Trans
TCONS_00099311 solute carrier family 7 (amino acid transporter light chain, L system), member 5 novel protein coding ENST00000589372 600 289 UTR5 Trans
TCONS_00099312 solute carrier family 7 (amino acid transporter light chain, L system), member 5 novel protein coding ENST00000589372 600 289 UTR5 Trans
TCONS_00108999 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000589372 782 577 UTR5 Trans
TCONS_00109000 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000589372 782 577 UTR5 Trans
TCONS_00109009 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000589372 782 577 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000589372 782 577 UTR5 Trans
TCONS_00109012 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000589372 782 577 UTR5 Trans
TCONS_00109013 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000589372 782 577 UTR5 Trans
TCONS_00109014 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000589372 782 577 UTR5 Trans
TCONS_00116668 desmoglein 3 novel protein coding ENST00000589372 537 302 UTR3 Trans
TCONS_00116668 desmoglein 3 novel protein coding ENST00000589372 631 303 UTR3 Trans
TCONS_00118582 centrosomal protein 76kDa novel protein coding ENST00000589372 687 379 UTR3 Trans
TCONS_00118582 centrosomal protein 76kDa novel protein coding ENST00000589372 855 585 UTR3 Trans
TCONS_00124891 zinc finger protein 540 novel protein coding ENST00000589372 618 301 UTR5 Trans
TCONS_00140732 NCK adaptor protein 2 novel protein coding ENST00000589372 600 300 UTR3 Trans
TCONS_00141667 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000589372 602 290 UTR3 Trans
TCONS_00141679 Rho guanine nucleotide exchange factor (GEF) 4 novel protein coding ENST00000589372 602 290 UTR3 Trans
TCONS_00147093 ATPase family, AAA domain containing 2B novel protein coding ENST00000589372 627 297 UTR3 Trans
TCONS_00148048 potassium voltage-gated channel, subfamily G, member 3 novel protein coding ENST00000589372 628 313 UTR3 Trans
TCONS_00148450 coiled-coil domain containing 88A novel protein coding ENST00000589372 620 301 UTR3 Trans
TCONS_00163367 runt-related transcription factor 1 novel protein coding ENST00000589372 632 292 UTR3 Trans
TCONS_00165715 LIM domain kinase 2 novel protein coding ENST00000589372 546 292 UTR3 Trans
TCONS_00165721 LIM domain kinase 2 novel protein coding ENST00000589372 546 292 UTR3 Trans
TCONS_00166381 GRB2-related adaptor protein 2 novel protein coding ENST00000589372 610 300 UTR3 Trans
TCONS_00185516 transcribed_unprocessed_pseudogene novel protein coding ENST00000589372 647 281 UTR5 Trans
TCONS_00185519 transcribed_unprocessed_pseudogene novel protein coding ENST00000589372 647 281 UTR3 Trans
TCONS_00194655 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000589372 832 595 UTR3 Trans
TCONS_00195828 LRP2 binding protein novel protein coding ENST00000589372 603 292 UTR5 Trans
TCONS_00199319 sorting nexin 24 novel noncoding ENST00000589372 611 312 noncoding Trans
TCONS_00200901 GM2 ganglioside activator novel protein coding ENST00000589372 600 288 UTR3 Trans
TCONS_00200902 GM2 ganglioside activator novel protein coding ENST00000589372 600 288 UTR3 Trans
TCONS_00204896 erythrocyte membrane protein band 4.1 like 4A novel protein coding ENST00000589372 642 307 UTR5 Trans
TCONS_00204911 erythrocyte membrane protein band 4.1 like 4A novel noncoding ENST00000589372 637 301 noncoding Trans
TCONS_00204916 erythrocyte membrane protein band 4.1 like 4A novel protein coding ENST00000589372 637 301 UTR3 Trans
TCONS_00213738 enoyl-CoA delta isomerase 2 novel protein coding ENST00000589372 576 300 UTR3 Trans
TCONS_00235281 NADH dehydrogenase (ubiquinone) complex I, assembly factor 6 novel protein coding ENST00000589372 763 409 UTR5 Trans
TCONS_00240688 metastasis suppressor 1 novel protein coding ENST00000589372 626 292 UTR5 Trans
TCONS_00252827 discs, large homolog 3 (Drosophila) novel protein coding ENST00000589372 640 302 UTR5 Trans

Sequence

>TCONS_00252827 (1449 nt)
CCGGGGTTCAGCGCTCGGGTGAGGAGCTGGTGGCGTCGGCAGGTTCGAGGCGATTCGAGCTCCAGCTAGGATGATCGAGGTTGTTTGCAACGACCGTCTG
GGGAAGAAGGTCCGCGTTAAATGCAACACGGATGATACCATCGGGGACCTTAAGAAGCTGATTGCAGCCCAAACTGGTACCCGTTGGAACAAGATTGTCC
TGAAGAAGTGGTACACGATTTTTAAGGACCACGTGTCTCTGGGGGACTGTATCCTTTGTGTGACTTTTTGAGGAAGCATCTACATACCCAGCCTCGGTTA
TCTGTTCAAAACTAAAGTCTGCATGAGCTTATGCATATTAAGTGTTTAACTTAATACGTGGCACATGGTGAGCACTTAGAAAATGGGAGCTAGGTAATTA
TTTGGTTGGGGAGGAGAGTGGTTGGTGAAATAGTTTGACTTCAAGTTCAAAATATTTATTACTGACCTCCACCTGAGTGCTGGACAGTAGGTCAGGGTGG
GGTGAGACTCAGGCATATCTATTGTGCAAAAGGAGCAGAAACTTTTTACAATTTTTATTTTATTTATTTATTTTTTTGAGACAGTCTGGCTCTGTCGCCC
AGGCTGGAGTGCAGTGGCACGATCTTGACCCACTGCAACCTCCACCTCCCGGGTTCAAGCAATTCTGCCTCAGCTTCCCAAGTAGCTGGGATTACAGGTG
TGTGCCACCACTCCCTGCTAGTTTTTGTATTTTTAGTAGAGATGAGGTTCCACCATGTATGCCAGGCTAGTCTCAAACTCCTGGCCTCAAGTGATCCTCC
CGCCTCGGCCTCCCAAAGTGCTGGGATTATAGCCGTGAGCCACTGTGCCTGGCCTAGAAGGAACAGAAACTTTTTTTTTTTTTTTTGAGATGGAGTTTTG
CTCTTGTTGCCCAGGCTGGAGTGCAGTGGTACAATCTTGGCTCACTGCAGCCTCTACCTCCCAGGTTTAAGCGATTTTCCTGTCTCAGCCTTCCAAGTAG
CTGGGATTACAGGTGCCCACCACCACACCCAGCTAACTTTTTGTATTTTTAGTAGAGACAGGGTTTCATCGTGTTGGCCAGGCTGGTCTCAAACTCCTGA
CGTCAAGTGAGCCACCTGCTTCGTCCTCTCAAAGTGCTGGGATTACAGGTGTGAGCCACTGCACCCAGCCAGAAATTCTTTTGTAAAGTTTTGGTTCTCT
CCAAATAAAAATGGCCTGGTCCAAAATGGGCTTCCTTAGCCCTGGGCTGAGACCTCAGGCCACCTGACCCGGCTGTGAATGGATGAGAGGGGTGGGGACG
GAAGTCAGAGTCAGGATTCCTTAACACCTTTCCTTCAGATGAAATCCACGATGGGATGAACCTGGAGCTTTATTATCAATAGATGAGAATCCTCATCTTC
CTGCCCCGCTTTCCTCTCCCATCCTCATCCCCCACACTGGGATAGATGCT

Expression



Full and truncated open reading frames discovered in TCONS_00252827

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.