Detailed information on ENST00000589403

lncRNA-RNA interactions

Number of interactions: 53

Potential function Interacting transcript Gene description Transcript biotype lncRNA id Alignment score (LAST) Alignment length Transcript region involved in interaction Genomic orientation of interacting RNAs
ENST00000227155 CD82 molecule protein coding ENST00000589403 614 304 UTR3 Trans
ENST00000327473 tumor necrosis factor, alpha-induced protein 8-like 1 protein coding ENST00000589403 629 295 UTR3 Trans
ENST00000378004 Rho GTPase activating protein 26 protein coding ENST00000589403 645 297 UTR3 Trans
ENST00000448214 antisense antisense ENST00000589403 532 299 noncoding Trans
ENST00000463899 N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase) processed transcript ENST00000589403 504 288 noncoding Trans
ENST00000513143 podoplanin protein coding ENST00000589403 550 299 UTR5 Trans
ENST00000553127 spermatogenesis associated, serine-rich 2 protein coding ENST00000589403 602 306 UTR3 Trans
ENST00000620139 melanoregulin protein coding ENST00000589403 601 297 UTR3 Trans
TCONS_00004719 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 novel protein coding ENST00000589403 644 292 UTR3 Trans
TCONS_00004721 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 novel protein coding ENST00000589403 644 292 UTR3 Trans
TCONS_00030130 calcium/calmodulin-dependent protein kinase II gamma novel protein coding ENST00000589403 690 300 UTR3 Trans
TCONS_00030165 antisense novel protein coding ENST00000589403 532 299 UTR5 Trans
TCONS_00030588 cytoplasmic polyadenylation element binding protein 3 novel protein coding ENST00000589403 645 297 UTR3 Trans
TCONS_00034642 CD82 molecule novel protein coding ENST00000589403 614 304 UTR3 Trans
TCONS_00034643 CD82 molecule novel protein coding ENST00000589403 614 304 UTR3 Trans
TCONS_00037377 NAD synthetase 1 novel protein coding ENST00000589403 646 299 UTR5 Trans
TCONS_00039782 GRAM domain containing 1B novel protein coding ENST00000589403 649 275 UTR5 Trans
TCONS_00041296 RIC3 acetylcholine receptor chaperone novel protein coding ENST00000589403 637 265 UTR3 Trans
TCONS_00041298 RIC3 acetylcholine receptor chaperone novel protein coding ENST00000589403 637 265 UTR3 Trans
TCONS_00050741 spermatogenesis associated, serine-rich 2 novel protein coding ENST00000589403 602 306 UTR3 Trans
TCONS_00050741 spermatogenesis associated, serine-rich 2 novel protein coding ENST00000589403 656 296 UTR3 Trans
TCONS_00076763 protein phosphatase 1, regulatory subunit 13B novel protein coding ENST00000589403 627 296 UTR3 Trans
TCONS_00098644 fatty acid 2-hydroxylase novel protein coding ENST00000589403 601 286 UTR3 Trans
TCONS_00098645 fatty acid 2-hydroxylase novel protein coding ENST00000589403 601 286 UTR3 Trans
TCONS_00098647 fatty acid 2-hydroxylase novel protein coding ENST00000589403 601 286 UTR3 Trans
TCONS_00108999 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000589403 657 297 UTR5 Trans
TCONS_00109000 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000589403 657 297 UTR5 Trans
TCONS_00109009 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000589403 657 297 UTR5 Trans
TCONS_00109011 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000589403 657 297 UTR5 Trans
TCONS_00109012 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000589403 657 297 UTR5 Trans
TCONS_00109013 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000589403 657 297 UTR5 Trans
TCONS_00109014 trans-golgi network vesicle protein 23 homolog C (S. cerevisiae) novel protein coding ENST00000589403 657 297 UTR5 Trans
TCONS_00116668 desmoglein 3 novel protein coding ENST00000589403 603 308 UTR3 Trans
TCONS_00116668 desmoglein 3 novel protein coding ENST00000589403 624 297 UTR3 Trans
TCONS_00135631 zinc finger protein 841 novel protein coding ENST00000589403 648 290 UTR3 Trans
TCONS_00165085 SPECC1L-ADORA2A readthrough (NMD candidate) novel protein coding ENST00000589403 633 272 UTR3 Trans
TCONS_00165085 SPECC1L-ADORA2A readthrough (NMD candidate) novel protein coding ENST00000589403 633 265 UTR3 Trans
TCONS_00165089 SPECC1L-ADORA2A readthrough (NMD candidate) novel protein coding ENST00000589403 633 272 UTR3 Trans
TCONS_00165089 SPECC1L-ADORA2A readthrough (NMD candidate) novel protein coding ENST00000589403 633 265 UTR3 Trans
TCONS_00165090 SPECC1L-ADORA2A readthrough (NMD candidate) novel protein coding ENST00000589403 633 272 UTR3 Trans
TCONS_00165090 SPECC1L-ADORA2A readthrough (NMD candidate) novel protein coding ENST00000589403 633 265 UTR3 Trans
TCONS_00165341 TTC28 antisense RNA 1 novel protein coding ENST00000589403 621 299 UTR5 Trans
TCONS_00186316 KIAA0232 novel protein coding ENST00000589403 652 299 UTR3 Trans
TCONS_00190498 palladin, cytoskeletal associated protein novel protein coding ENST00000589403 603 271 UTR3 Trans
TCONS_00194682 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000589403 669 298 UTR3 Trans
TCONS_00194686 E74-like factor 2 (ets domain transcription factor) novel protein coding ENST00000589403 669 298 UTR3 Trans
TCONS_00213738 enoyl-CoA delta isomerase 2 novel protein coding ENST00000589403 524 298 UTR3 Trans
TCONS_00219453 WD repeat domain 27 novel protein coding ENST00000589403 642 277 UTR3 Trans
TCONS_00235281 NADH dehydrogenase (ubiquinone) complex I, assembly factor 6 novel protein coding ENST00000589403 604 298 UTR5 Trans
TCONS_00235708 oxidation resistance 1 novel protein coding ENST00000589403 622 276 UTR3 Trans
TCONS_00243503 proprotein convertase subtilisin/kexin type 5 novel protein coding ENST00000589403 522 303 UTR3 Trans
TCONS_00243507 proprotein convertase subtilisin/kexin type 5 novel protein coding ENST00000589403 522 303 UTR3 Trans
TCONS_00253752 queuine tRNA-ribosyltransferase 1 pseudogene 1 novel protein coding ENST00000589403 598 274 UTR3 Trans

Sequence

>TCONS_00253752 (739 nt)
GTGAAGTCTTCTACAAGTGTCCTATTTGTCCAATGGCGTTTAAGTCTGCCCCAAGCACACATTCCCACGCCTACACACAGCATCCTGGCATCAAGATAGG
AGAACCAAAGTAAAGACCTTGTCCAAAAACGTTACCTATTATTTATGCTCTTGTCACGAATTTTTGCTCAACAAGTAAATATTTATATTTTTTTCTTAAG
ATGAATTTTTTTTTTTTTTTGAGACAAGAGTCTCGCTCTGTCGCCCAGGCTAGAGTGCAGTGGTGCGATCTTGGCTCACTGCAACCTCCGTCTCCTGGGT
TCAAGCGATTCTCCTGCTTCAGCCTCCTGAGTAGCTGGGACTACAGGTGCATGCCACCACTCCTGGCTAATTTTTTGTATTGTTAATAGAGATGGGGTTT
CAAGGTGTTAGCCAGGATGGTGTCGATCTCCTGACCTCGTGATCCACCTGCCTTGGCCTCCCAAAGTGCTAGGATTACAGGCGTGAGCCACGGCACCCAG
CCTCTTAAGATGATTTTTGACAACTCCTAGGAAAACTATTTTTTAGAAACCCTGTCATCTTTAAATTTTTCCATAGTTCCTTTTTTATAGGGTACACTTT
TGCTTAAAAAGTAATATTTTTAAGATGAAGGCAACTTAAGACACTGGTTACTGAATTTAACTTCATAGCCAGTATAAGTCCCTGATTAGTAAATTTTTTT
TTGCCTTAATCTTGCTCTTAATTTGATTGATTTTTGCTTT

Expression



Full and truncated open reading frames discovered in TCONS_00253752

In silico ORF/peptide predictions
Nothing found.


RiboTaper predictions from Ribo-Seq data (HEK293 cell line)
Nothing found.

BLAST search results

No hits found.